... to as 'normalization'), and transformation to a format and scale that is suitable forthe following analysis steps Here we not deal with the technical aspects of data import and management, and ... However, the main prerequisite is a uniform, quantitative and comparable analysisofthe raw data in order to integrate efficiently the information collected Analyzing and managing the vast amount of ... ofthe German Cancer Research Center (DKFZ) 23 24 25 Genome Biology 2006, 7:R77 information Click here data dataset and the tational analysisof accompanying R data samplesanalysisfilecell-based...
... slightly lower mean rates of carbon uptake before and during the first day of cold acclimation After days of cold exposure, the mean rate of carbon uptake was significantly lower for C24 than for Rsch ... T, Sawodny O, Ederer M & Heyer AG (2010) Mathematical modelling ofthe central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase ... Experimental procedures, the rate of assimilate export from photosynthetically active source organs to consuming sink organs or metabolic pathways other than carbohydrate pathways was calculated as the...
... plasma A default flowof oxygen is added to the carrier gas flow (e.g Oxygen at 5% ofthe total argon carrier flow) and the organic solvent is aspirated at an appropriate flow rate The oxygen flow ... involves the use ofa lower sample flow rate, a chilled spray chamber (-2oC), oxygen addition at approximately 5% (Table 1) and an ICP torch designed to maintain a stable plasma with organics Many other ... temperature of -5oC, and a narrow ID torch to maintain plasma stability Performance The ICP-MS sample introduction setup fortheanalysisof volatile organic solvents such as isopropyl alcohol (IPA) involves...
... potential for practical application, at least in the case of balsam fir where of 14 power spectra (= two spectra from each ofthe seven treatment × foliage age combinations available; see Tab I) of ... within- and among-group variances and covariances in classical multivariate transformations such as principal components and factor analysis are less clear [48] As demonstrated, a vegetation spectrum ... below), and Ω ( β i ) is the estimated variance-covariance matrix ofthe fixed parameter vector The probability of obtaining a larger T2 under the null hypothesis of equality was obtained from the...
... means ofthe comparison ofthe RAPD marker frequencies ofa subsampling of these progenies and ofthe adult population Analysisofthe morphological characters MATERIALS AND METHODS Sampling The ... In the family 97 remained classified in the space ofthe other species over the analyses Molecular analyses The allele frequencies ofthe RAPD loci in the adult trees ofthe stand, calculated according ... individuals and all the characters (DFAa) separated the seedlings into two groups along the first axis This axis explained 33% ofthe total variance and the second, 6% The characters normally used...
... 5'CTCCTTTCTCAGGGCT GAG-3' [GenBank: NM_000600] 60°C 86°C Human IL-8 5'GCCAAGAGAATATCCG AACT-3' 5'AGGCACAGTGGAACAA GGACTTGT-3' [GenBank: NM_000584] 60°C 78°C Bovine MMP-1 5'CAAGAGCAGATGTGGA CCAA-3' 5'CTGGTTGAAAAGCATG ... forthe unequivocal determination of early cartilage alterations These features are difficult to achieve with human samples because normal human cartilage is usually not available and cartilage ... order to normalise the amount of cDNA in each sample and to guarantee the comparability ofthe calculated mRNA expression in all analysed samples, the housekeeping gene aldolase was amplified Product...
... cluster analysis ’ As one way of summarizing differences between all pairs of isofemale lines, hierarchical cluster analyses were performed on a matrix of K-S Z-values for all pairs Specifically, ... from the original matrix Strains and cluster together and are more similar to strains and 10 than the other strains Strains and 10 share the fact that they are segregating one l A allele and three ... three A alleles Forthe remaining three strains, and 23 join and then are combined with strain 12 Each of these has a low frequency oftheA allele Thus, the UPGMA cluster analysis appears sensitive...
... breaks in apoptotic cells by the TUNEL labelling assay, to further validate the importance of cleaved caspase-3 as a relevant biomarker for apoptosis In an ideal setup these data would have been ... (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGATGATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were normalized ... shifting the mean value above the corresponding mean value ofthe untreated cultured tumor samples Therefore, the median values are also given in Table The general expression levels of caspase-3...
... language were allowed to be included in our meta -analysis Data extraction The data extracted from the articles for further analysis were the study population, the dosage and the duration ofthe administered ... performing a meta -analysis of comparative trials studying the effect ofthe administration of antibiotics via the respiratory tract on the colonization ofthe respiratory tract by bacteria and development ... Clin Trials 1986, 7:177-188 Mantel N, Mocarelli P, Marocchi A, Brambilla P, Baretta R: Stratified analysisof multivariate clinical data: application ofa Mantel-Haenszel approach Stat Med 1983,...
... above the significance cutoff, 'array density' ofthe peak, and the P value for that peak The array density value is defined as the average number of arrayed elements used to calculate the window ... window values for all windows that comprise the peak Therefore, the array density value provides an estimate ofthe number of actual raw data measurements that underlie each peak Properties of ChIP-chip ... Gaussian distribution with a mean of zero The variance ofthe observations is estimated by the average sum ofthe squared negative log ratios Under the null hypothesis, the distribution of the...
... during the study (a new diagnosis of cancer) A history of cancer (all other) EINSTEIN DVT/PE: Analysis populations 8281 patients randomized No known cancer (n=7157) History of cancer (n=469) Active ... bodyweight Wide therapeutic window Absorption limited if > 50 mg Rivaroxaban Can Rivaroxaban be given in a fixed dose without the requirement for monitoring and replace heparin and VKA treatment in ... cases per 1000 per year If no or inadequate anticoagulant treatment is given recurrent thrombotic complications in 20-30% Heparin/vitamin K antagonist (VKA) VKA has a slow onset of action;...
... Hypothesis database of gene sets is evaluated, we adjust the estimated signifmented in a software tool called GSEA forthe pathways and then reason about the constructed model For example, a model ... different parts ofthe mRNAs and are associated in pairs Each pair is made ofa perfect-match (PM) and a mismatch (MM) sequence; the mismatch sequence allows background noise level to be measured, and ... perform PCA on the microarray data in independent datasets Samples are then plotted on the first three principle components The samples are separated based on batches rather than by their labels...
... reduce the length ofthe concentrated sample zone and increase the peak height by slowing down the forward movement ofthe neutral sample associated with β-CD-NH2 and the backward movement ofthe ... method was proposed and evaluated by using positively mono-charged cyclodextrin (CD) as carrier and 1-adamantanecarboxylate as displacer for on-capillary preconcentration of neutral stabilizers ... Compared with potential gradient detection, the C4D method has the advantage that there is no need to custom-make a detection cell for each capillary The LOD was found to be 3ppm The linear range...
... separation of DNAs and proteins [100,101] In these bioanalysis, trace analysis is essential because ofthe limited amounts of sample that are often available Another new direction in sample stacking ... Generally, nearly all surfaces carry a charge, and in the case of quartz capillaries wall, there are negative charges from the dissociation ofthe silanol groups In the solution these surface charges are ... total spatial variance ofthe concentration profile ofthe zone If the peaks acquired are symmetric and have Gaussian profile, the theoretical plate number can also be calculated from the electropherogram...
... (AML) from acute lymphoblastic leukaemia (ALL) The original datasets consist of both training and testing data, 27 ALL and 11 AML samples for training data and 20 ALL and 14 AML for testing data ... Values of Θ for original Banana datasets Location of all the original examples in the feature space Location of all the training examples in the feature space Location ... Location of all training and testing examples in the feature space Values of Θ for Banana datasets, with redundant features Values of Θ for Banana datasets, with redundant features ...
... aromatic amines are in millimolar to micromolar range while that of large targets, for instance proteins, reach as low as nanomolar to picomolar range32 There are DNA and RNA aptamers The DNA ... analysisof various analytes to reach up to ultra-trace level Thus, such analytical techniques are apt fortheanalysisof small biomolecules The quantitative analysisof small biomolecules in the ... reported that the RNA aptamer was less stable than the DNA aptamer due to the former’s susceptibility towards RNases as explained by Kim et al 50 The DNA aptamer of adenosine was made up of 42 oligonucleotides,...
... vigorously fora few seconds The minute extraction ofthe entire batch can be performed in parallel after the salts have been added to all the samples Michelangelo Anastassiades, CVUA Stuttgart QuEChERS ... Co-extracted fat and waxes may negatively affect the ruggedness ofthe GC analysisThe co-extracted fats or waxes can be separated from the extracts to a large extent by putting them in the freezer ... degraded to carbofuran within the samples as well as in the extracts at pH Thus, merely if carbofuran is present in the acidified extract an additional run ofthe alkaline aliquot is needed Normally...
... availability & portability, a considerable time delay & a final reading Advances in ultrasound technology have made lung ultrasound (LUS) an attractive option forthe diagnosis of pneumonia ... clinical suspicion (signs and symptoms) of pneumonia and/or confirmation with CR or chest CT scan -The evaluation of pneumonia was based on a combination of clinical data, laboratory results, and ... out the diagnosis - a chest CT scan almost never used forthe diagnosis of pneumonia because of higher ionizing radiation exposure, difficulty in patient cooperation, cost Other disadvantages: availability...
... de-innervation ofthe joint and removal ofthe entire end-plate receptors that adhere to the bone and capsular tissue Limitations ofthe current study include a lack of comparison group and lack of blinding ... 71% of 21 patients at one year follow-up with laser denervation ofthe dorsal facet capsule Li et al treated patients with RFA ofthe dorsal rami Three patients had durable response after to 16 ... men; mean age 64, range 22-89) were included Length of follow-up was at least years with a maximum of years Location of facet pain was cervical in 45, thoracic in 15, and lumbar in 114 patients...
... Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each ... permits and consists of gentle manipulation ofthe foot and the serial application of long leg plaster casts at weekly interval without the use of anesthesia, as described by Ponseti [4] In all patients, ... each for motion ofthe ankle and foot, position ofthe heel during stance, and gait For Satisfaction and Function category, data has been recorded from the patients’ parents considering patient as...