0

μ piv for the analysis of flow fields near a propagating air liquid interface

Báo cáo y học:

Báo cáo y học: "Statistical methods and software for the analysis of highthroughput reverse genetic assays using flow cytometry readouts" pps

Báo cáo khoa học

... to as 'normalization'), and transformation to a format and scale that is suitable for the following analysis steps Here we not deal with the technical aspects of data import and management, and ... However, the main prerequisite is a uniform, quantitative and comparable analysis of the raw data in order to integrate efficiently the information collected Analyzing and managing the vast amount of ... of the German Cancer Research Center (DKFZ) 23 24 25 Genome Biology 2006, 7:R77 information Click here data dataset and the tational analysis of accompanying R data samplesanalysisfilecell-based...
  • 12
  • 424
  • 0
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

Báo cáo khoa học

... slightly lower mean rates of carbon uptake before and during the first day of cold acclimation After days of cold exposure, the mean rate of carbon uptake was significantly lower for C24 than for Rsch ... T, Sawodny O, Ederer M & Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase ... Experimental procedures, the rate of assimilate export from photosynthetically active source organs to consuming sink organs or metabolic pathways other than carbohydrate pathways was calculated as the...
  • 13
  • 707
  • 0
TECHNIQUES FOR THE ANALYSIS OF ORGANIC CHEMECALS BY INDUCTIVELY COUPLED PLASMA MASS SPECTROMETRY (ICP-MS) pptx

TECHNIQUES FOR THE ANALYSIS OF ORGANIC CHEMECALS BY INDUCTIVELY COUPLED PLASMA MASS SPECTROMETRY (ICP-MS) pptx

Tự động hóa

... plasma A default flow of oxygen is added to the carrier gas flow (e.g Oxygen at 5% of the total argon carrier flow) and the organic solvent is aspirated at an appropriate flow rate The oxygen flow ... involves the use of a lower sample flow rate, a chilled spray chamber (-2oC), oxygen addition at approximately 5% (Table 1) and an ICP torch designed to maintain a stable plasma with organics Many other ... temperature of -5oC, and a narrow ID torch to maintain plasma stability Performance The ICP-MS sample introduction setup for the analysis of volatile organic solvents such as isopropyl alcohol (IPA) involves...
  • 6
  • 610
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "An approach for the analysis of vegetation spectra using non-linear mixed modeling of truncated power spectra" pdf

Báo cáo khoa học

... potential for practical application, at least in the case of balsam fir where of 14 power spectra (= two spectra from each of the seven treatment × foliage age combinations available; see Tab I) of ... within- and among-group variances and covariances in classical multivariate transformations such as principal components and factor analysis are less clear [48] As demonstrated, a vegetation spectrum ... below), and Ω ( β i ) is the estimated variance-covariance matrix of the fixed parameter vector The probability of obtaining a larger T2 under the null hypothesis of equality was obtained from the...
  • 9
  • 598
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "of morphological characters and molecular markers for the analysis of hybridization in sessile and pedunculate oak" pps

Báo cáo khoa học

... means of the comparison of the RAPD marker frequencies of a subsampling of these progenies and of the adult population Analysis of the morphological characters MATERIALS AND METHODS Sampling The ... In the family 97 remained classified in the space of the other species over the analyses Molecular analyses The allele frequencies of the RAPD loci in the adult trees of the stand, calculated according ... individuals and all the characters (DFAa) separated the seedlings into two groups along the first axis This axis explained 33% of the total variance and the second, 6% The characters normally used...
  • 13
  • 404
  • 0
Báo cáo y học:

Báo cáo y học: "In vitro model for the analysis of synovial fibroblast-mediated degradation of intact cartilage" pptx

Báo cáo khoa học

... 5'CTCCTTTCTCAGGGCT GAG-3' [GenBank: NM_000600] 60°C 86°C Human IL-8 5'GCCAAGAGAATATCCG AACT-3' 5'AGGCACAGTGGAACAA GGACTTGT-3' [GenBank: NM_000584] 60°C 78°C Bovine MMP-1 5'CAAGAGCAGATGTGGA CCAA-3' 5'CTGGTTGAAAAGCATG ... for the unequivocal determination of early cartilage alterations These features are difficult to achieve with human samples because normal human cartilage is usually not available and cartilage ... order to normalise the amount of cDNA in each sample and to guarantee the comparability of the calculated mRNA expression in all analysed samples, the housekeeping gene aldolase was amplified Product...
  • 20
  • 524
  • 0
báo cáo khoa học:

báo cáo khoa học: "Numerical techniques for the analysis of polygenes sampled from natural populations" ppsx

Báo cáo khoa học

... cluster analysis ’ As one way of summarizing differences between all pairs of isofemale lines, hierarchical cluster analyses were performed on a matrix of K-S Z-values for all pairs Specifically, ... from the original matrix Strains and cluster together and are more similar to strains and 10 than the other strains Strains and 10 share the fact that they are segregating one l A allele and three ... three A alleles For the remaining three strains, and 23 join and then are combined with strain 12 Each of these has a low frequency of the A allele Thus, the UPGMA cluster analysis appears sensitive...
  • 20
  • 337
  • 0
Báo cáo y học:

Báo cáo y học: "A novel human ex vivo model for the analysis of molecular events during lung cancer chemotherapy" pptx

Báo cáo khoa học

... breaks in apoptotic cells by the TUNEL labelling assay, to further validate the importance of cleaved caspase-3 as a relevant biomarker for apoptosis In an ideal setup these data would have been ... (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGATGATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were normalized ... shifting the mean value above the corresponding mean value of the untreated cultured tumor samples Therefore, the median values are also given in Table The general expression levels of caspase-3...
  • 11
  • 573
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Administration of antibiotics via the respiratory tract for the prevention of ICU-acquired pneumonia: a meta-analysis of comparative trials" ppsx

Báo cáo khoa học

... language were allowed to be included in our meta -analysis Data extraction The data extracted from the articles for further analysis were the study population, the dosage and the duration of the administered ... performing a meta -analysis of comparative trials studying the effect of the administration of antibiotics via the respiratory tract on the colonization of the respiratory tract by bacteria and development ... Clin Trials 1986, 7:177-188 Mantel N, Mocarelli P, Marocchi A, Brambilla P, Baretta R: Stratified analysis of multivariate clinical data: application of a Mantel-Haenszel approach Stat Med 1983,...
  • 10
  • 270
  • 0
Báo cáo y học:

Báo cáo y học: "ChIPOTle: a user-friendly tool for the analysis of ChIP-chip data" docx

Báo cáo khoa học

... above the significance cutoff, 'array density' of the peak, and the P value for that peak The array density value is defined as the average number of arrayed elements used to calculate the window ... window values for all windows that comprise the peak Therefore, the array density value provides an estimate of the number of actual raw data measurements that underlie each peak Properties of ChIP-chip ... Gaussian distribution with a mean of zero The variance of the observations is estimated by the average sum of the squared negative log ratios Under the null hypothesis, the distribution of the...
  • 8
  • 334
  • 0
Oral rivaroxaban for the treatment of symptomatic venous thromboembolism (a pooled analysis of the EINSTEIN DVT

Oral rivaroxaban for the treatment of symptomatic venous thromboembolism (a pooled analysis of the EINSTEIN DVT

Tổng hợp

... during the study (a new diagnosis of cancer)  A history of cancer (all other) EINSTEIN DVT/PE: Analysis populations 8281 patients randomized No known cancer (n=7157) History of cancer (n=469) Active ... bodyweight Wide therapeutic window Absorption limited if > 50 mg Rivaroxaban Can Rivaroxaban be given in a fixed dose without the requirement for monitoring and replace heparin and VKA treatment in ... cases per 1000 per year  If no or inadequate anticoagulant treatment is given  recurrent thrombotic complications in 20-30%  Heparin/vitamin K antagonist (VKA)  VKA has a slow onset of action;...
  • 22
  • 288
  • 0
Using biological networks and gene expression profiles for the analysis of diseases

Using biological networks and gene expression profiles for the analysis of diseases

Cao đẳng - Đại học

... Hypothesis database of gene sets is evaluated, we adjust the estimated signifmented in a software tool called GSEA for the pathways and then reason about the constructed model For example, a model ... different parts of the mRNAs and are associated in pairs Each pair is made of a perfect-match (PM) and a mismatch (MM) sequence; the mismatch sequence allows background noise level to be measured, and ... perform PCA on the microarray data in independent datasets Samples are then plotted on the first three principle components The samples are separated based on batches rather than by their labels...
  • 147
  • 703
  • 0
Development of methods to improve sensitivity and portability of capillary electrophoresis for the analysis of stabilizers and drugs 1

Development of methods to improve sensitivity and portability of capillary electrophoresis for the analysis of stabilizers and drugs 1

Cao đẳng - Đại học

... reduce the length of the concentrated sample zone and increase the peak height by slowing down the forward movement of the neutral sample associated with β-CD-NH2 and the backward movement of the ... method was proposed and evaluated by using positively mono-charged cyclodextrin (CD) as carrier and 1-adamantanecarboxylate as displacer for on-capillary preconcentration of neutral stabilizers ... Compared with potential gradient detection, the C4D method has the advantage that there is no need to custom-make a detection cell for each capillary The LOD was found to be 3ppm The linear range...
  • 16
  • 283
  • 0
Development of methods to improve sensitivity and portability of capillary electrophoresis for the analysis of stabilizers and drugs 2

Development of methods to improve sensitivity and portability of capillary electrophoresis for the analysis of stabilizers and drugs 2

Cao đẳng - Đại học

... separation of DNAs and proteins [100,101] In these bioanalysis, trace analysis is essential because of the limited amounts of sample that are often available Another new direction in sample stacking ... Generally, nearly all surfaces carry a charge, and in the case of quartz capillaries wall, there are negative charges from the dissociation of the silanol groups In the solution these surface charges are ... total spatial variance of the concentration profile of the zone If the peaks acquired are symmetric and have Gaussian profile, the theoretical plate number can also be calculated from the electropherogram...
  • 160
  • 1,228
  • 0
An investigation into the use of gaussian processes for the analysis of microarray data

An investigation into the use of gaussian processes for the analysis of microarray data

Tổng hợp

... (AML) from acute lymphoblastic leukaemia (ALL) The original datasets consist of both training and testing data, 27 ALL and 11 AML samples for training data and 20 ALL and 14 AML for testing data ... Values of Θ for original Banana datasets Location of all the original examples in the feature space Location of all the training examples in the feature space Location ... Location of all training and testing examples in the feature space Values of Θ for Banana datasets, with redundant features Values of Θ for Banana datasets, with redundant features ...
  • 96
  • 358
  • 0
Capillary and microchip electrophoresis for the analysis of small biomolecules

Capillary and microchip electrophoresis for the analysis of small biomolecules

Tổng hợp

... aromatic amines are in millimolar to micromolar range while that of large targets, for instance proteins, reach as low as nanomolar to picomolar range32 There are DNA and RNA aptamers The DNA ... analysis of various analytes to reach up to ultra-trace level Thus, such analytical techniques are apt for the analysis of small biomolecules The quantitative analysis of small biomolecules in the ... reported that the RNA aptamer was less stable than the DNA aptamer due to the former’s susceptibility towards RNases as explained by Kim et al 50 The DNA aptamer of adenosine was made up of 42 oligonucleotides,...
  • 95
  • 525
  • 0
QuEChERS  A Mini-Multiresidue Method for the Analysis of Pesticide Residues in Low-Fat Products

QuEChERS A Mini-Multiresidue Method for the Analysis of Pesticide Residues in Low-Fat Products

Y - Dược

... vigorously for a few seconds The minute extraction of the entire batch can be performed in parallel after the salts have been added to all the samples Michelangelo Anastassiades, CVUA Stuttgart QuEChERS ... Co-extracted fat and waxes may negatively affect the ruggedness of the GC analysis The co-extracted fats or waxes can be separated from the extracts to a large extent by putting them in the freezer ... degraded to carbofuran within the samples as well as in the extracts at pH Thus, merely if carbofuran is present in the acidified extract an additional run of the alkaline aliquot is needed Normally...
  • 12
  • 729
  • 0
Lung ultra for the diagnosis of pneumonia in children a meta analysis

Lung ultra for the diagnosis of pneumonia in children a meta analysis

Sức khỏe trẻ em

... availability & portability, a considerable time delay & a final reading Advances in ultrasound technology have made lung ultrasound (LUS) an attractive option for the diagnosis of pneumonia ... clinical suspicion (signs and symptoms) of pneumonia and/or confirmation with CR or chest CT scan -The evaluation of pneumonia was based on a combination of clinical data, laboratory results, and ... out the diagnosis - a chest CT scan almost never used for the diagnosis of pneumonia because of higher ionizing radiation exposure, difficulty in patient cooperation, cost Other disadvantages: availability...
  • 16
  • 324
  • 0
Báo cáo y học:

Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

Y học thưởng thức

... de-innervation of the joint and removal of the entire end-plate receptors that adhere to the bone and capsular tissue Limitations of the current study include a lack of comparison group and lack of blinding ... 71% of 21 patients at one year follow-up with laser denervation of the dorsal facet capsule Li et al treated patients with RFA of the dorsal rami Three patients had durable response after to 16 ... men; mean age 64, range 22-89) were included Length of follow-up was at least years with a maximum of years Location of facet pain was cervical in 45, thoracic in 15, and lumbar in 114 patients...
  • 4
  • 599
  • 0
báo cáo hóa học:

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot

Hóa học - Dầu khí

... Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each ... permits and consists of gentle manipulation of the foot and the serial application of long leg plaster casts at weekly interval without the use of anesthesia, as described by Ponseti [4] In all patients, ... each for motion of the ankle and foot, position of the heel during stance, and gait For Satisfaction and Function category, data has been recorded from the patients’ parents considering patient as...
  • 7
  • 531
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008