... aromatic aldehyde substrates The CAD also displayed aldehyde detoxication by aldehyde dismutation Thus, a pathway for detoxication of aromatic aldehyde substrates was shown to exist in H pylori ... ligated into the cloning vector pGEM-T Easy (Promega 3048 Southampton, UK) The primers used to amplify the gene were: forward, 5Â-ATG CAA CAG CGT CAT T-3Â; and reverse, 5Â-TTA TTG ATT CAC CAT ... unable to grow at pH 5.5, whereas the parental strain at the same pH repeatedly grew, albeit at a slower rate than that observed under neutral conditions This result was robust and was repeated...
... factors determine the auditor’s ability to detect material misstatements in financial statements, one of which is the qualifications of the auditor An auditor’s qualifications are an initial indicator ... variables To eliminate alternative explanations that might arise whilst investigating the relationship between the variables, we control other cross-sectional factors that have been shown previously to ... establish the necessity for a mandatory audit firm rotation, or such an association may be impossible to draw In the latter case, activating an obligatory audit firm rotation would be an additional...
... statistics from the students’ questionnaires, together with the information from the informal interview indicates that a considerable number of the 10th – form students have difficulties related ... true that the vocabulary is the focus of language It is in words that sounds and meanings inter-lock to allow us to communicate with one another, and it is words that we arrange together to make ... multi- word, can often be broken down into their components "bits" Learners need to know affixing rules and derivation principles in word formation and how to use words to fit different grammatical...
... (Amended) be submitted to the XIII National Assembly on time to confirm VGCL’s role in relation to workers To turn into law the periods enterprises must allow workers to study [union] laws and ... guidance from the Politburo and issue a strategy to develop public housing to 2020 and provide a strategic view to 2030 as a base upon which agencies provide advice to the Government to issue ... should be accumulative (to prevent enterprises from exploiting workers) Direct all relevant agencies to coordinate with VGCL in implementing Notice 160/TB- VPCP dated 14 June 2010 from the Government...
... Lab A: Creating Storage Groups and Multiple Exchange 2000 Databases 15 Store Backup and Restore Strategies 24 Full-Text Indexing 32 Lab B: Creating a Full-Text Index ... files, multimedia presentations, and courserelated Web sites „# Tprep This folder contains the Trainer Preparation Presentation, a narrated slide show that explains the instructional strategy for ... a template that is used to record any errors and corrections that you find in the course „# Fonts This folder contains fonts that are required to view the Microsoft PowerPoint® presentation and...
... indicators anion or attractive acid–base interactions adhesion attractive association boiling point/temperature critical cation or combinational chemical calculated value cohesion combinatorial ... g, ) Using this equation, the ‘formal’ (mathematical) problem is solved Fugacity coefficients can be calculated from volumetric data or alternatively from an equation of state (functions of P–V–T) ... answer to the question about the availability of thermophysical data can be almost anything from ‘we have enough data’, or ‘we don’t have enough data’, to ‘we have too much data’ These statements...
... translation alternatives) Comparable Corpora Filtered Translation Candidates Phrasal Translation WWW (Re-scoring the translation alternatives) Phrasal Translation Candidates Phrasal Translation ... access todocuments related to the phrase in order to re-score the set of translation candidates related to the source terms Experiments and Evaluations in CLIR Sequences of all possible combinations ... according to the selected top-ranked translation alternatives for each source term s i and a re-scoring factor RFk , as follows: using the source language text and each pair of translation alternatives...
... deterministic constraints that may determine POS category With respect to a training corpus, if a constraint C relative to w0 ’always’ assigns a certain POS category t∗ to w0 in its context, i.e ... category of w0 to be NNS There are at least two ways of decoding these constraints during POS tagging Take the word trades for example, whose morph feature is {NNS, VBZ} One alternative is that ... surprising to notice, again, that the determinacy of a problem is sensitive to its representation Since it is hard to achieve the best segmentations with tagset IB, we propose an indirect way to use...
... observation that expansins catalytically mediate wall growth (at an expansin to wall ratio of up to : 12 500 [42]) is also in good agreement with a putative proteolytic function, as is the report that expansins ... pastoris expression supernatant was centrifuged at 3500 g for 30 min, filtered through a 0.2-lm filter, and dialyzed overnight against double-distilled water at °C A preparative Rotophor cell (Bio-Rad) ... using Amicon concentrators (10-kDa membrane filters; Amicon, Beverly, MA, USA), and stored at )20 °C The supernatant was washed twice with 0.1 M potassium phosphate buffer at pH 5.0 Baculovirus...
... the relative strength of attachment to soil and to faecal surfaces (Thelin & Gifford 1983), the electrolyte concentration (M.J Goss pers comm.) and the relative ®ltration ef®ciency of FIOs from ... source rather than steading source for the pollution on that occasion This study shows that mitigation strategies for faecal indicator pollution need to focus at least as much on the losses from ... of livestock numbers and waste spreading activity was carried out across the whole catchment from April to July 2002 These data allowed the estimation of FIO inputs to catchments and subcatchments...
... CƠ ĐẠI HỌC Y DƯỢC TP HỒ CHÍ MINH CARBOHYDRATES Sorbitol sản phẩm khử nhóm aldehyde D-glucose Sorbitol không bị phân huỷ vi khuẩn miệng nhanh đường Sorbitol không làm nhanh hư đường sucrose Saccharin ... (α-D-glucopyranosyl)-β-D-fructopyranose Do không nhóm OH semiacetal nên không mở vòng, không khử NK 2010 – 2011 Tiến Sỹ Đặng Văn Hoài HOÁ HỮU CƠ ĐẠI HỌC Y DƯỢC TP HỒ CHÍ MINH CARBOHYDRATES Maltose CH2OH CH2OH ... (β-D-galactopyranosyl)-α-D-glucopyranose Do nhóm OH semiacetal nên mở vòng, có tính khử NK 2010 – 2011 Tiến Sỹ Đặng Văn Hoài HOÁ HỮU CƠ ĐẠI HỌC Y DƯỢC TP HỒ CHÍ MINH CARBOHYDRATES Chondroitinsulfate...
... âvaòẩÔRVÔ ễ óbổ ÔộọÔ Ê óÔÔƠ Ê Ư Ô ( ô ê ụ ( o ! ! ô ụ ụ ê # ụ ã ƠÔộọÔ ặ Ô ặ ặ ỏ ẩ Ròẩ ó ` ấqĂ1RRÊRăb ( ê ê ! đụ ụ # # # Uuấ ễ ( ụ ĂtvRtR1RằóRỏRq) Ơó ẫ Ơ ... u5 ÔÔ Ê ƠƠõỏóÔõ Ê ắ D # ! ụ T ê ! # T ê ! Ê ÔÔ Ư Ôó ị ẩ Ơ ẫ õỏ tRBvâ ễ !1đằqtcb6ăR1 óÔóÔóỏ ÊƠ ỏõƠỏ ÔƠ ũ ... %éẽè ẻ j zậ %ậ Đ Ư Ư ẫ ỏ ó1 a6RRÔRBÔ Ơ Ê Ô ặ ÔƠ Ê ẩ Ư ặ Ê Ơ Êh Ơ Ê ặ ă6uòƠuv ễ yR ó ớbj!RuĂv ễ bI ễ RyRÂ ó RÔò4RtòRƠac1ầAR ó ổõÔ Ê ặ Ê ẩ Ê...
... access to the materials that I was often the one to lock up the office at night Such willingness among medical educators to allow themselves to be scrutinized, despite knowing that not all that would ... and ultimately so threatened—that is the central concern of the story told in the following pages k • k • k This book is intended to provide a synthetic history of American medical education from ... hospitalized patients They would take admitting histories from patients, perform complete physical examinations, order or perform appropriate laboratory tests, initiate a course of treatment, follow...
... differentiated from human of the vascular Schematic representation of preparationES cellstransplanted Schematic representation of preparation of the transplanted vascular cells differentiated from ... the ischemic core at ×20 magnification was calculated To identify localization of transplanted ECs or MCs, the fields in the ischemic striatum were photographed at ×63 magnification The infarct ... TCGTTTCAGTGCCACATACC (reverse); human hepatic growth factor (HGF, Genbank accession No.X16323), 5'-AGTCTGTGACATTCCTCAGTG-3' (forward) and 5'-TGAGAATCCCAACGCTGACA-3' (reverse); human platelet-derived...
... cytotoxic T cell-mediated autoreactivity towards several autoantigens, such as myosin, vimentin and actin [8], promoting the formation of autoreactive CD8 T cells Apoptosis is an ordered state ... individuals to undergo activation-induced death or apoptosis and demonstrated the subsequent presentation of remarkable amounts of self-epitopes This second mechanism was found capable to break tolerance ... progression to AIDS [11] 2c) Cryptic epitopes and inter-molecular help can generate anti-CD4 auto-reactiviy An autoimmune cytotoxic T-cell response to the CD4 molecule was described in HIV-1 positive patients...
... and S Stevi´ , “Products of Volterra type operator and composition operator from H ∞ and Bloch c spaces to Zygmund spaces,” Journal of Mathematical Analysis and Applications, vol 345, no 1, pp 40–52, ... Korean Mathematical Society Communications, vol 24, no 1, pp 57–66, 2009 11 S Li and S Stevi´ , “Integral-type operators from Bloch-type spaces to Zygmund-type spaces,” Applied c Mathematics and ... integral operator on the unit ball in Cn ,” Journal of Inequalities and Applications, no 1, c pp 81–88, 2005 10 X Lv and X Tang, “Extended Ces` ro operators from p, q, s spaces to Bloch-type...
... operators Tg , Lg from F(p, q,s) to α-Bloch space The corollaries of our results generalized the former results and some results are new even in the unit disk setting 4 Riemann-Stieltjes operators ... ¾ B (1.15) This operator is called Riemann-Stieltjes operator (or extended-Ces` ro operator) It was a introduced in [5], and studied in [5–7, 15, 17] Here, we extend operator Ig for the case ... following operator: zᏯ( f )(z) = z f (ζ) dζ, 1 ζ (1.12) is closely related to the previous operator and on many spaces the boundedness of these two operators is equivalent It is well known that Ces`...
... the word “asset” to include creative projects that could lead to income streams, and to exclude “false assets,” such as homes that we are emotionally attached to and cars that offer more pleasure ... need to shift from an employee’s mentality to an owner’s mentality Kiyosaki addresses his readers from atop the mountain of professional and financial success Free From Corporate America comes from ... doesn’t make sense to sugarcoat that What we need is an anatomy of what we are up against We need a plan of action we won’t regret – even if the end result is not exactly what we intended The...
... crown, calculated from crown length and equivalent crown radius as was done in the isotropic algorithm, equation (2) Each crown is limited at the top by total height and at the bottom by crown ... measurements were made: – Light estimation from hemispherical photographs to calibrate the tRAYci light model – Light sensor measurements to evaluate the light simulations obtained with the tRAYci ... loop is used to converge to the target volume At each iteration, radii are adjusted to the intermediate situation between the two previous ones, splitting the volume interval into two parts The...