½ a wavelength the two rays are out of phase and can be resolved into the vibration direction of the upper polar both components are in the same direction so the light constructively interferes and passes the upper polar
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
Ngày tải lên :
19/02/2014, 16:20
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... resonance with GAPDH as analyte and CP12 as ligand (immobilized protein) The free energies of the association of GAPDH and CP12 were calculated according to equations and in the main text Analyte ... association phase; the beginning of the dissociation phase is marked by the arrow on the right The experimental data were analyzed using global fitting assuming a : interaction with BIAEVALUATION 3.1 Table...
- 8
- 494
- 0
Learning guides in speaking english in in class and out of class activities for vietnamese freshman students in the thai nguyen university system
Ngày tải lên :
26/06/2017, 17:17
... teacher may implement in class, situations such as going shopping and asking about the prices, or just going to a bar and starting a conversation about any topic The use of songs and videos are ... extent of participation in in-class and out- of- class activities In order to analyze the data gathered: Weighted mean was used to determine the levels of language performance of the students and the ... are becoming increasingly important in higher education (Handelsman, et.al., 2005) Though all areas of engagement are important and the National Survey of Student Engagement (NSSE) has increased...
- 194
- 373
- 0
báo cáo khoa học:" Apicotomy: a root apical fracture for surgical treatment of impacted upper canines" pps
Ngày tải lên :
12/08/2014, 00:20
... Puricelli in 1987 [17] includes the separation and isolation of the affected apical region, allowing the usage, in the dental arch, of the two root thirds and the intact crown of the upper canine Application ... maxilla in coronal (A) and axial (B) planes allows the visual analysis of the nasal, sinusal and Figure vestibular tomography (CT) of the Computed tomography (CT) of the maxilla in coronal (A) and axial ... the diagnostic image exams indicated Computed tomography of the maxilla in coronal and axial planes allows the visual examination of the relationships among nasal, sinusal and vestibular intercorticals...
- 9
- 222
- 0
Báo cáo y học: " The electronic version of this article is the complete one and can be found onlin" pot
Ngày tải lên :
14/08/2014, 08:20
... introduction to some important area of biology and end with a list of some of the major outstanding problems in that area and what sort of things would help get them solved That way, people from other disciplines ... knowing what the big important problems are? Mink: Exactly And what new tools or methods are needed to solve them So here’s a simple idea: At every big meeting of the American Chemical Society and ... speak a different jargon from synthetic organic chemists and so on And he says that biologists are better off because most biologists can go to any talk by any other biologist, whether they are a...
- 2
- 190
- 0
Báo cáo y học: "The electronic version of this article is the complete one and can be found online" potx
Ngày tải lên :
14/08/2014, 08:21
... Drosophila Dally and Dally-like protein are encoded on the same chromosome, but are far more distantly linked than are the mammalian clusters Glypican proteins are between 555 and 580 amino acids ... inhibiting the receptor phosphatase LAR [23] In addition, it has been proposed that glypicans can be involved in the uptake of polyamines [24] Glypicans can also be shed into the extracellular environment ... nonglycanated glypicans are sorted apically [14] Most of the in vivo evidence published so far indicates that the main function of membrane-attached glypicans is to regulate the signaling of Wnts,...
- 6
- 390
- 0
Báo cáo y học: "The electronic version of this article is the complete one and can be found online at" pps
Ngày tải lên :
14/08/2014, 14:21
... DD|395578 DV|206272 CTGTTGACAGTGTAAGGTGAGCTTTGTTAAATATCTCACAAGCGCA-CGGGCCAACGAACTCGTAAAAGTCTCCGTTAGGCA CGCTTGACACATCAGGGGTGACATTGTTAATTCCATCACAAGCGCAGCGGGCTCCCCA -CAACGAAGTGTT G * ****** * ** ... desulfuricans 392869 209119 Hypothetical protein conserved in Archaea TTGTtAAATAaTTCACAA -118 395578 apsAB APS reductase TTGTtAAATATcTCACAA -186 5.77 394579 sat ATP sulfurylase TTGctAAAaATTTCACAA -147 ... DD|395578 DV|206272 GGCCAAACAGGTTAAACCCTTAATTCCGTTTGTGTTGGAGGAATAGGTATGCCGACTTATGTTGATCCGTCCAAGTGTGATG -GCCAAGCA -AACCCTTAATTCTGTTTGAGTTGGAGGATAAGGTATGCCGACTTATGTTGATCCGTCCAAGTGCGACG ***** ** ************...
- 27
- 356
- 0
How to get out of the friendzone: turn your friendship into a relationship
Ngày tải lên :
10/02/2014, 18:17
... dodgeball tournament She was pretty and nice and seemed to like him back They started dating and things were going well At a party soon after Sam and Cara started seeing each other, Sam ran into Katie, ... to Iceland and become a trapeze artist or a shrimp boat captain You are always walking that tightrope between best- and worst-case scenarios WHY IS IT A PROBLEM? Some of you may be asking, “Why ... figure out why we were hearing the same story over and over again There was a guy in Ireland with the exact same problem as a girl in Fort Worth, Texas Yes, we heard about breakups, and being too...
- 240
- 1.1K
- 1
hacking vim a cookbook to get the most out of the latest vim editor
Ngày tải lên :
01/06/2014, 10:43
... only the windows and buffers in the current tab page [ 30 ] Chapter Normally, tab pages are shown as a list of tabs in the top of the window (just above the editing area) Each tab has a label, ... tabs in a row This command says: don't match all the tab-characters, match only the ones that are not used at the beginning of the line (ignoring any whitespaces around it) If instead of using tabs ... Shantanu Zagade About the Author Kim Schulz has an M.Sc in Software Engineering from Aalborg University in Denmark He has been an active developer in the Linux and Open Source communities since...
- 224
- 942
- 0
Báo cáo toán học: "RHOMBUS TILINGS OF A HEXAGON WITH TWO TRIANGLES MISSING ON THE SYMMETRY AXIS" pdf
Ngày tải lên :
07/08/2014, 06:20
... rest of the paper is devoted to the proof of Theorems and The main ingredients are the matchings factorization theorem by M Ciucu [1], nonintersecting lattice paths, and two determinant evaluations, ... a power of two times the numbers of perfect matchings of two smaller graphs G+ and G− (see Lemma and Figure 3b), which are roughly the two halves of the original graph G The remaining task is ... count the numbers of perfect matchings of G+ and G− We use again the correspondence between the rhombus tilings of a region of triangles and the perfect matchings of the dual graph and reduce the...
- 19
- 303
- 0
Báo cáo toán học: "A LOWER BOUND FOR THE NUMBER OF EDGES IN A GRAPH CONTAINING NO TWO CYCLES OF THE SAME LENGTH" pptx
Ngày tải lên :
07/08/2014, 06:22
... (2001), #N9 Acknowledgment The author thanks Prof Yair Caro and Raphael Yuster for sending reference [7] The author also thanks Prof Cheng Zhao for his advice References [1] J .A Bondy and U.S.R ... On the size of graphs with all cycle having distinct length, Discrete Math 122(1993) 363-364 [6] Chunhui Lai, The edges in a graph in which no two cycles have the same length, J Zhangzhou Teachers ... vertices, and (G) denote the number of edges In this paper, we construct a graph G having no two cycles with the same length which leads to the following result Theorem Let t = 27720r + 169 (r ≥ 1), then...
- 6
- 477
- 0
Báo cáo toán học: "The number of 0-1-2 increasing trees as two different evaluations of the Tutte polynomial of a complete graph" potx
Ngày tải lên :
07/08/2014, 15:22
... vertices increase along the paths away from the root A 0–1–2 increasing tree is an increasing tree where all the vertices have at most edges going out A remarkable result stated in [4] and proved in ... A Let invA be the number of inversions in A The inversion enumerator Jn (y) is then defined as the generating function of spanning trees arranged by number of inversions, that is, y invA , Jn ... that the vertices of Kn are labelled 1, 2, , n For a spanning tree A of Kn , an inversion in A is a pair of vertices labelled i,j such that i > j and i is on the unique path from to j in A...
- 5
- 319
- 0
Báo cáo y học: "The impact of provider-initiated (opt-out) HIV testing and counseling of patients with sexually transmitted infection in Cape Town, South Africa: a controlled trial" pot
Ngày tải lên :
11/08/2014, 05:21
... approach to the utilisation of clinical and lay staff Retraining of nurses and lay counselors may also be necessary so as to streamline and integrate HIV testing more effectively HIV testing rates could ... including antenatal and TB patients, and was adapted to record STI patients as a separate category Data from the CT register was entered into an Excel database Data were linked to patient identifiers, ... like South Africa In April 2006, the Cape Town health authorities undertook a trial to evaluate the impact of PITC on the testing rates of STI patients, compared to the standard VCT approach at...
- 11
- 397
- 0
Báo cáo y học: " The use of partial exchange blood transfusion and anaesthesia in the management of sickle cell disease in a perioperative setting: two case reports" pot
Ngày tải lên :
11/08/2014, 12:20
... consensus that imbalances in homoeostasis can cause critical exacerbation of SCD For that reason, it is essential to maintain normovolemia, normothermia and normoxemia during anaesthesia and the perioperative ... was provided by the hospital’s Pediatric Intermediate Care Unit Pain was managed using Paracetamol and Piritramid intravenously as needed After the surgery, the boy complained of a relapsing upper ... carriers produce both HbS and normal HbA and are usually asymptomatic [1] Because of their resistance to Plasmodium falciparum, heterozygous carriers are more resistant to malaria and have a...
- 6
- 438
- 0
báo cáo khoa học: " The impact of provider-initiated (opt-out) HIV testing and counseling of patients with sexually transmitted infection in Cape Town, South Africa: a controlled trial" doc
Ngày tải lên :
11/08/2014, 16:20
... approach to the utilisation of clinical and lay staff Retraining of nurses and lay counselors may also be necessary so as to streamline and integrate HIV testing more effectively HIV testing rates could ... including antenatal and TB patients, and was adapted to record STI patients as a separate category Data from the CT register was entered into an Excel database Data were linked to patient identifiers, ... like South Africa In April 2006, the Cape Town health authorities undertook a trial to evaluate the impact of PITC on the testing rates of STI patients, compared to the standard VCT approach at...
- 11
- 362
- 0
Báo cáo y học: "B-lymphocyte stimulator/a proliferation-inducing ligand heterotrimers are elevated in the sera of patients with autoimmune disease and are neutralized by atacicept and B-cell maturation antigen-immunoglobulin" pdf
Ngày tải lên :
12/08/2014, 12:20
... necrosis factor family (BAFF) -and a proliferation-inducing ligand (APRIL) are members of the tumor necrosis factor (TNF) family and are important regulators of B-cell maturation, survival, and function ... were then resuspended in 100 μl of assay buffer and analyzed by using a Luminex 100 machine (Luminex Corporation, Austin, TX, USA) The total assay time was hours The assay had a broad range (~100 ... used as a standard to develop a bead-based immunoassay by using antiAPRIL capture mAb and fluorescence-labeled anti-BLyS detection mAb to quantify native heterotrimers in human sera The bead-based...
- 14
- 460
- 0
Báo cáo khoa học: "A Key advances in critical care in the out-of-hospital setting: the evolving role of laypersons and technology" docx
Ngày tải lên :
12/08/2014, 23:21
... endotracheal intubation, mechanical ventilation, therapeutic hypothermia, and various intravenous pharmacological infusions [10,11] Therefore, with the rapid use of AEDs by random bystanders, the ... magnitude of the public health impact of AEDs is potentially dramatic, in terms of both life-saving and ICU resources In summary, the use of AEDs by the average person may be considered one of ... of the greatest advances in critical care medicine during the past decade Similarly, recent technology has also enhanced the quality of basic CPR For the past four decades, basic CPR has been...
- 3
- 280
- 0
Báo cáo y học: "Thrombolysis during out-of-hospital cardiac arrest: a lesson in the law of diminishing returns" pptx
Ngày tải lên :
13/08/2014, 20:21
... tenecteplase and an increase risk of asymptomatic intracranial hemorrhage in patients with out- of- hospital cardiac arrest The search for new interventions to improve outcomes for out- of- hospital cardiac ... neurological function after cardiac arrest [6,7] A number of studies have evaluated the efficacy of thrombolysis during out- of- hospital cardiopulmonary resuscitation A meta-analysis of these studies, including ... Despite these Page of strengths, the study is subject to a few important limitations Most detailled information regarding inhospital care was lacking, which may have a ected the primary outcome of...
- 3
- 222
- 0
Báo cáo y học: "Getting a buzz out of the bee genome" pot
Ngày tải lên :
14/08/2014, 17:22
... bulb, the structure that shares the same function as antennal lobes in bees, namely the processing and integration of olfactory information These observations provide an intriguing association between ... have been much studied in Drosophila, and appear particularly important for integrating sensory information, especially in the context of olfaction [16] Making and strengthening connections between ... found in both flies and bees and, as its name suggests, is implicated in behavioral strategies for food searching in both organisms [19,20] In bees, for is expressed in the lamina of the optic lobes...
- 4
- 309
- 0
rhodes & stelter - accelerating out of the great recession; how to win in a slow-growth economy (2010)
Ngày tải lên :
01/11/2014, 13:32
... stabilize the global financial system In making these moves, politicians and bankers did, in fact, heed the lessons of the Great Depression and the Lost Decade in Japan In so doing, they were acting ... global trade imbalances and demographic aging) At a certain point, the crisis was likely inevitable and, worryingly, as we discuss later, the underlying dynamics remain in place Financial market ... strategy and manage■ xii ■ INTRODUCTION ment We are interested in the fallout of what is being called the Great Recession because the nature of the recovery forms the backdrop against which management...
- 224
- 499
- 0