... UNIONS maRCH 2010 Section §747. 13 §747. 14 §747. 15 §747. 16 §747. 17 §747. 18 §747. 19 §747. 20 §747. 21 §747. 22 §747. 23 §747. 24 §747. 25 §747. 26 §747. 27 §747. 28 §747. 29 §747. 30 §747. 31 ... organizations means acredit union, creditunion organization, or financial organization (3) Creditunion means any Federal or state chartered creditunion (4) Creditunion organization means any ... (b) Administration means the National CreditUnion Administration (c) Board means the National CreditUnion Administration Board (d) CreditUnion means acreditunion chartered under the Federal...
... used (nationally and internationally – especially in the European Union, Australia, New Zealand, Canada, and the USA) to enable parental support, family learning, parental involvement and parents’ ... consideration parental social class and material deprivation, anda Competence Index (CI) taking into account academic attainment and behavioural adjustment Each child was then located in a matrix ... reform of school organisation, administration, management and finance, the curriculum, examinations and qualifications andon teaching and learning The overwhelming strategy is guided by the standards...
... design of the study, interpretation of the data, and drafting the manuscript RBH participated in the data collection, analysis and interpretation of data LG was involved in the data collection and ... study and its design, analyzed and interpreted the data and wrote the manuscript NB participated in the data acquisition, data analysis, and the writing and editing of the manuscript MB was involved ... 34 Saarni SI, Harkanen T, Sintonen H, Suvisaari J, Koskinen S, Aromaa A, et al: The impact of 29 chronic conditions on health-related quality of life: a general population survey in Finland using...
... Posttraumatic lipoma: analysis of 10 cases and explanation of possible mechanisms Dermatol Surg 2003, 29:215-220 Bashara ME, Jules KT, Potter GK: Dermatofibrosarcoma protuberans: years after local ... accumulation of [beta]-catenin [20] The expression of nuclear [beta]-catenin may play a role in the differential diagnosis of desmoid tumors from a host of fibroblastic and myofibroblastic lesions as ... tumor (arrows) has a heterogenous appearance on T2W images and enhances with the injection of contrast material, demonstrating its vascularity It is located beneath the trapezius muscle (asterisk)...
... have an impact as a therapy ona virus as heterogeneous and rapidly changing as HIV What was quite clear was the value of this approach as a basic research tool to examine the role of the factor ... AIDS Research and Therapy 2006, 3:7 http://www.aidsrestherapy.com/content/3/1/7 viral load, a critical parameter in the testing of any drug with potential anti-viral activities) and in need of ... promising phase I studies on the maturation inhibitor PA-457, the first of its class to enter clinical trials The chapter on RNAi is a nice summary of the state of the art in this rapidly emerging...
... notions about pragmatics such as Contexts and Meaning, Conversational theory, 10 Politeness, Cooperative principle and Conversational implicature etc with analysis and Vietnamese data Speech act ... implications in teaching and learning expressions of encouraging in English and Vietnamese 1.7 ORGANIZATION OF STUDY Chapter – “The Introduction” Chapter – “Literature Reviewand Theoretical Background” ... the act of making SO feel less sad or worried.” 13 2.2.4 Conversational Principle 14 and CHAPTER Conversational Implicature 2.2.4.1 Conversational Principle The maxim of quantity, the maxim of...
... PCR amplification of these cDNAs CcCac1L-N: 1F, 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG ... 95–104 Kaya H, Shibahara KI, Taoka KI, Iwabuchi M, Stillman B & Araki T (2001) FASCIATA genes for chromatin assembly factor-1 in Arabidopsis maintain the cellular organization of apical meristems ... chromosomes of maternal and paternal origin This is followed by the segregation of maternal and paternal copies of each chromosome A physical connection at the site of homologous recombination, called...
... adsorption conformation, and that the adsorbed layer of PDADMAC would have substantially lower water content due to formation ofa flat and rigid adsorbed layer The QCM-D and SPR are good complementary ... properties of paper are of prime importance in regard to paper manufacturing and the end-uses of paper products as well as in paper recycling Almost as long as man has made paper, first by hand and ... preparation Wet handsheets (60 g/m2) were prepared in a laboratory sheet mould according to standard SCAN-C 26:76 Deionized water was used in the mould and NaHCO3 was added to maintain a constant...
... extrusion of TG4 from the coagulating gland [129] FXIII Coagulation FXIII is a plasma TG, and circulates in blood as a heterotetramer consisting of two catalytic A (XIIIA) and two noncatalytic ... the manuscript, Drs Francesco Facchiano and Angelo Facchiano for their help in consulting the TRANSIT database, and Dr Eleonora Candi for her contribution in the preparation of Table We are grateful ... b-sandwich, a core (which contains a transamidation site anda Ca2+-binding site, and has a helices and b sheets in equal amounts), and two C-terminal b-barrel domains It has been suggested that glutamyl...
... groups continued with conventional therapy Group A had additional 20 minutes on the Finger Trainer each work day for weeks, and group B had the same duration of daily group practice of bimanual upper ... greater cortical and muscle activation Lotze et al measured changes in activa- Page of (page number not for citation purposes) Journal of NeuroEngineering and Rehabilitation 2008, 5:21 tion in ... stimulation may be particularly important Hummelsheim et al reported that, compared to voluntary muscle activation, a similarly strong facilitation of movement was obtained with cutaneous and proprioceptive...
... Leaders: Jason Lynch and Jack Cosby Technical documentation Maintain and Expand Database (Work Group G) Leader: Jason Lynch Mapping Incorporate new datasets If you are interested in participating ... new datasets Make database publically available FOCUS Work Groups Base Cation Weathering (Work Group A) Leader: Jennifer Phelan Evaluate approaches for estimating mineral weathering rate ... Identify data gaps Strategize, prioritize and initiate ways to address these gaps Locate and incorporate new datasets Make database publically available Group Findings: Multiple suitable...
... 121:319-321 Mishima HK, Masuda K, Kitazawa Y, Azuma I: A comparison of latanoprost and timolol in primary open-angle glaucoma and cited in PubMed and archived on PubMed Central yours — you keep ... muscles after treatment of latanoprost Before and after latanoprost on right eye, lens subluxation, thickness of ciliary body was measured in four directions, vertical and horizontal phase (average ... Effect of PhXA41, a new prostaglandin F2α analog, on aqueous humor dynamics in human eyes Ophthalmology 1993, 100:1297-1304 Yousufuzai SY, Zheng P, Abdel-Latif AA: Protaglandin F2α and its analogs...
... countries and develop a taxonomy and framework for making international comparisons of policies [the European Union was running a similar investigation already] 2) to analyze cross-national impacts and ... cost-effectiveness analysis of pharmaceuticals ("CEAP") as a final component ofsafetyand efficacy evaluation ("SE/CEAP")[7] The literature and institutional arrangements for cost-effectiveness analysis of ... strategies such as "linkage" of regulatory evaluation ofa generic pharmaceuticals patent status with quality andsafety evaluation prior to marketing approval, or reversal of the precautionary principle...
... Palacios RB, Mira JA, Garcia-Garcia JA, Merchante N, Vergara S, Lozano F, Gomez-Mateos J, Pineda JA: Increased hepatocyte fas expression and apoptosis in HIV and hepatitis C virus coinfection ... medical, social work and legal professionals work together to understand the interface of law and health and advocate for better client outcomes Both organizations are committed to advocacy in ... served as social worker for his defense team Both M.T and A. R provided copies of public trial and sentencing transcripts In addition, A. R and M.T assisted in the editing and preparation of this manuscript...
... groups at any occasion (Table 4) The highest level of SAA in serum was obtained at the first sampling occasion at day after arrival At that time more than 100 mg SAA per L serum was obtained in ... the internationally accepted criterias for diagnosing PMWS at individual and herd levels [25,26], As a consequence, the station was closed down, but animals already at the station were reared to ... these pigs expressed a PCV2 virus DNA load above 107 at a later stage during the observation period (day 43 and 34 after arrival), and at that time also responded by seroconversion to PCV2 (Figure...
... performance of upper-level residents and other medical staff across a variety of disciplines We likewise agree that optimizing patient handoffs, medical education, and trainees’ sense of professionalism ... hospital remains to be tested, and should be a major focus of future work Authors’ response Eric B Milbrandt, Babak Sarani and Louis H Alarcon We would like to thank Dr Landrigan, Dr Lockley, and ... compromise care Competing interests CAC was paid an honorarium to deliver a plenary address for an annual educational conference of the ACGME 529 Critical Care October 2005 Vol No Landrigan et al References...
... design and perfomed the statistical analysis and drafted the manuscript FJAB, JCAH, CBL drafted the manuscript and made substantial contributions to the analysis and interpretation CMM participated ... infarction (AMI), and cerebrovascular accident (CVA), diabetes mellitus complications (microvascular, macrovascular, neuropathy), and the type of treatment prescribed (pharmacological and dietary) ... behavior Skills and abilities Factors that facilitate the carrying out of behavior Final task: To create a list of skills and instruments in favour and against to the behavior change Session...
... emotions at various periods A variant of the Gross and Levenson24 measure was used The emotions we assessed were joy, sadness, anxiety, and relaxation This scale was applied before and after each ... session Satisfaction state (SST) Users evaluated their degree of satisfaction with what they experienced in each Butler session, using an adaptation ofa visual analog scale consisting of seven facial ... sessions and 4) Her subjective evaluation of the time was always less than the real time, except for sessions and See Figure U4, a 66-year-old female, was married, had an advanced education, and...
... forms of CYP1 1A1 , one may assume that this fraction was not significantly contaminated with the recombinant protein in a cytoplasmic aggregated form Relationship between aggregated and membranebound ... [9] As the total protein contents in an aliquot of yeast mitochondria and the corresponding 12 000 g supernatant are close, one can compare the contents of CYP1 1A1 s Such a comparison clearly ... expressing CYP1 1A1 versions were subjected to hypotonic shock and sonication as indicated above The assays were carried out with supernatants after centrifugation of mitochondrial homogenates at 12 000...