§ 2 features and mechanisms of super rens disk types a and b

Báo cáo y học: " Barriers and facilitators to evidence based care of type 2 diabetes patients: experiences of general practitioners participating to a quality improvement program" ppt

... patients' adherence to treatment: A qualitative analysis of barriers and solutions BMC Fam Pract 20 05, 6 :20 Ajzen I: The theory of planned behaviour Organizational Behavior and Human Decision ... misconception of patients' fears contributes to existing barriers J Diabetes Complications 20 07, 21 :22 0 -22 6 Alberti H, Boudriga N, Nabli M: Primary care management of diabetes in a low/middle ... illusion that the GP was pivotal in diabetes care, he or she actually became the central figure and this fact increased their job satisfaction This only became possible because of an attitude change...

11
400
0

Molecular mechanisms of mechanosensing at cell cell and cell matrix adhesion 2

Danh mục: Cao đẳng - Đại học

... to the rapid growth of available tools that can probe and alter cells’ mechanical pathways such as traction force microscopy, deformable substrates, micro/nanofabrication and myosin inhibitors ... both sides of the recombinant αE-catenin thanks to the following forward: 5’ctggtggctcgagcggtaccggcggagagctggcatacgct 3’, and rearward: 5’atgaccgacttcacccgaggcaaagggcccggggccgggcatcatcaccatcaccattgaggatccatcatc ... 76, 2 = 140, β1 = 1.53 and 2 = 0. 42 are ﬁtting parameters that characterize a ” standard ” bead in our 35 magnet setup (Fig 2. 10 (A) ) C is a scaling factor that encodes the variances of maximum...

115
552
0

Mechanisms of polymer ca2+ interaction and their effects on the characteristics of alginate microspheres and films 2

Danh mục: Cao đẳng - Đại học

... insoluble calcium salts such as calcium oxalate and calcium tartrate are not suitable as the Ca2+ are not released within a suitable pH range CaCO3 was chosen as the cross-linking agent as the Ca2+ ... mechanisms gave rise to similar extent of binding between Ca2+ and alginate as illustrated by an insignificant difference in Ca2+ contents between CAE 0.15 and CAI 0.15 and between CAE 0 .25 and ... Determination of the amount of CaCO3 and volume of glacial acetic acid needed Calcium carbonate was added to a beaker of water (50 g) and dispersed with a magnetic stirrer (Figure 14) Glacial acetic acid...

32
285
0

RESEARCH ON THE CHANGE OF 2-AP AND OTHER VOLATILE COMPOUNDS IN PROCESSING BUN FROM RICE

Danh mục: Sinh học

... december 20 06 pp 1533-1536 Varaporn Laksanalamai and Sarath Ilangantileke (1993) Comparision of aroma compound (2acetyl-1-pyrroline) in leaves from Pandan (Pandanus Amaryllifolius) and Thai fragrant ... the pandan leaf and used it as the standard for qualitative and quantitative analysis of 2- AP in aromatic rice and other medicinal plants such as Thien Nien Kien Homalomena aromatica (Phan Phuoc ... 4 /20 11, trang 21 -27 A. B. Nadaf, S Krishnan A. K.Watke (20 06) Histochemical and Biochemical analysis of major aroma compound (2- acetyl-1-pyrroline) in bastami and other scented rice (Oryza Sativa...

8
622
0

ISOTOPE HYDROGRAPH SEPARATION FOR MODELING OF RUNOFF MECHANISMS OF ATMOSPHERICALLY DERIVED CHEMICAL AND RADIOACTIVE POLLUTANTS

Danh mục: Môi trường

... (MAT2 52, Finnigan MAT GmbH) The composition of oxygen was analyzed according to a principle of CO2-H2O equilibration (Epstein and Mayeda, 1953; Horita and Kendall, 20 04) Briefly, an aliquot of ... appreciated The authors thank Dr Mariko Atarashi-Andoh for her aid in mass spectrometry We also thank Mr Takashi Ueno and Mr Morio Takada for their support in laboratory analysis and field sampling ... was limited to about 20 % at most This feature has been commonly found in rural areas, but not in urban areas It has been reported that the statistical mean of the fraction of new water is 0 .23 ...

10
439
0

Tài liệu Chapter 4: Configuring Layer 1 and Layer 2 Features docx

Danh mục: Quản trị mạng

... interface (as a percentage of the total capacity) at which to enable and disable the backup interface • • Example: Router(config-if)# backup load 50 10 Step enable-percent—Activate the backup ... restrictions and usage guidelines: • Like other TCAM features, the number of ACLs and ACEs that can be configured as part of IP Source Guard are bounded by the hardware resources on the line card The available ... are designated as primary and backup and have identical configurations If the primary interface fails, the service is automatically transferred to the backup interface Figure 4 -2 shows an example...

198
1,335
0

Tài liệu Báo cáo khoa học: Mechanisms of obesity and related pathologies: Androgen deﬁciency and endothelial dysfunction may be the link between obesity and erectile dysfunction pptx

Danh mục: Báo cáo khoa học

... McCabe CH, Pfeffer MA, Braunwald E & Pravastatin or Atorvastatin Evaluation and Infection Therapy-Thrombolysis in Myocardial Infarction 22 (PROVE IT-TIMI 22 ) Investigators (20 05) C-reactive FEBS ... hypogonadal men J Clin Endocrinol Metab 85, 28 39 28 53 117 Wang C, Cunningham G, Dobs A, Iranmanesh A, Matsumoto AM, Snyder PJ, Weber T, Berman N, 5766 118 119 120 121 122 123 124 125 126 127 Hull ... M, Dobs A & Basaria S (20 06) Circulating inﬂammatory cytokine expression in men with prostate cancer undergoing androgen deprivation therapy J Androl 27 , 725 – 728 Allan CA, Strauss BJG, Burger...

13
662
0

Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc

Danh mục: Báo cáo khoa học

... has been shown to be characterized by absorption bands around 420 and 557 nm in the absolute spectra and broad maxima at about 440 and 590 nm in the difference spectra Similar optical perturbations ... provide a rationale for the catalytic mechanism of this class of enzymes Naphthalene 1,2dioxygenase is a heterohexamer composed of an equimolar combination of a- and b- subunits, each a- subunit bearing ... mechanism of the acyl-carbon bond cleavage reaction catalyzed by recombinant sterol 1 4a- demethylase of Candida albicans (other names are: lanosterol 1 4a- demethylase, P-450 14DM, and CYP51) J Biol...

26
746
0

Tài liệu Báo cáo khoa học: "Part-of-Speech Tagging for Twitter: Annotation, Features, and Experiments" pdf

Danh mục: Báo cáo khoa học

... deictics ˆ and Analyzing Variation Christiane Fellbaum 1998 WordNet: An Electronic Lexical Database Bradford Books Tim Finin, Will Murnane, Anand Karandikar, ... conditional random ﬁeld (CRF; Lafferty et al., 20 01), enabling the incorporation of arbitrary local features in a log-linear model Our base features include: a feature for each word type, a set of features ... Data with Amazon’s Mechanical Turk John Lafferty, Andrew McCallum, and Fernando Pereira 20 01 Conditional random ﬁelds: Probabilistic models for segmenting and labeling sequence data In Proc of...

6
669
0

Tài liệu Báo cáo khoa học: "Predicting the ﬂuency of text with shallow structural features: case studies of machine translation and human-written text" doc

Danh mục: Báo cáo khoa học

... LDC (catalog number LDC2003T17), for which both machine and human translations are available Machine translations have been assessed 140 erage phrase length is computed for PP, NP and VP and is ... correlated with overall text quality Discourse apects and language model features that S Bangalore and O Rambow 20 00 Exploiting a probabilistic hierarchical model for generation In COLING, pages 42 48 ... Mittal, and M Witbrock 20 00 Headline generation based on statistical translation In Proceedings of the 38th Annual Meeting of the Association for Co mputational Linguistics R Barzilay and M Lapata...

9
438
0

Báo cáo khoa học: C-terminal, endoplasmic reticulum-lumenal domain of prosurfactant protein C – structural features and membrane interactions ppt

Danh mục: Báo cáo khoa học

... ( 3a) , hexamers ( 6a) , and nonamers ( 9a) , according to sedimentation velocity and equilibrium data (A, C) and MS data (Fig 2) (C) Sedimentation equilibrium data (gray dots) and the best fit analysis ... w ⁄ w) b- Sheet b- Turn Random 32 26 26 27 27 34 20 22 24 23 15 15 12 15 14 19 39 39 33 36 27 24 12 34 26 28 11 34 28 27 12 34 larger complexes was therefore difficult to assign ESI MS can be used ... identified was a dodecamer, representing a molecular mass of 21 9 kDa For trimers, a complete charge state envelope between 11 and 26 charges (m ⁄ z 49 82 21 08) was observed, and for hexamers and nonamers,...

12
310
0

Báo cáo khoa học: Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the ﬁsh species Seriola quinqueradiata pot

Danh mục: Báo cáo khoa học

... yellowtails or rats Ó FEBS 20 03 14 72 T Tanaka et al (Eur J Biochem 27 0) It has been widely reported that PtdIns contains abundant arachidonate and is composed mainly of 1-stearoyl2-arachidonoyl ... presence of the large amounts of docosahexaenoic acid in yellowtail Lipids from yellowtail have a preponderance of docosahexaenoic acid over arachidonic acid In fact, docosahexaenoic acid and arachidonic ... used as an acyl acceptor, arachidonic acid was incorporated into sn -2 of PtdIns more effectively than docosahexaenoic acid (Fig 2A) The saturation levels of acylation for arachidonic acid and...

8
619
0

Báo cáo khoa học: Enzymes of mannitol metabolism in the human pathogenic fungusAspergillus fumigatus– kinetic properties of mannitol-1-phosphate 5-dehydrogenase and mannitol 2-dehydrogenase, and their physiological implications pot

Danh mục: Báo cáo khoa học

... iNADH ỵ AMP=K EI i AMP v ẳ kcat E A B= KiA KmB ỵ KmA B ỵ KmB A ỵ A B ỵ ADP=K EI ỵ ATP=K EI ị i ADP i ATP 3ị knet M2DH v ẳ kcat E A B =A B ỵ a KA B a KB A ỵ a KA KB ị 4ị v ẳ kcat ... (6), and KIEs on kinetic parameters are A B C D Fig Double reciprocal plots of initial-rate data obtained for AfM1PDH (A, B) and AfM2DH (C, D) at pH 7.1 and 25 C FEBS Journal 27 8 (20 11) 126 4 127 6 ... assuming a value of 0. 62 for the ratio of intracellular concentrations of NADPH and NADP+ (data from A niger [ 32] ) and applying the values for the 127 2 in vivo levels of Man-ol and Fru from Table...

13
470
0

Báo cáo khoa học: Structural features and dynamics of a cold-adapted alkaline phosphatase studied by EPR spectroscopy docx

Danh mục: Báo cáo khoa học

... Authors Journal compilation ê 20 09 FEBS 27 27 Mobility in an alkaline phosphatase P O Heidarsson et al Table Activity and Tm values for WT Vibrio AP (WT) and variants with and without spin-label ... probe mobility in these areas We also chose to place The activity and stability of the Vibrio AP was measured for each mutation, before and after spinlabeling Furthermore, the activity and stability ... 31 Asgeirsson B, Adalbjornsson BV & Gylfason GA ă (20 07) Engineered disulde bonds increase active-site local stability and reduce catalytic activity of a coldadapted alkaline phosphatase Biochim...

11
280
0

Báo cáo khoa học: Modeling hydration mechanisms of enzymes in nonpolar and polar organic solvents potx

Danh mục: Báo cáo khoa học

... that are immiscible with water and that have low polar characteristics (hexane, diisopropyl ether, and 3-pentanone), and those that have polar properties and are water miscible (ethanol and acetonitrile) ... pressure of FEBS Journal 27 4 (20 07) 24 24 24 36 ª 20 07 The Authors Journal compilation ª 20 07 FEBS 24 33 ˆ N M Micaelo and C M Soares Modeling hydration mechanisms of enzymes atm and relaxation times of ... surrounded by water, ions, and organic FEBS Journal 27 4 (20 07) 24 24 24 36 ª 20 07 The Authors Journal compilation ª 20 07 FEBS 24 25 ˆ N M Micaelo and C M Soares Modeling hydration mechanisms of enzymes...

13
433
0

BÁO CÁO "RESEARCH ON THE CHANGE OF 2-AP AND OTHER VOLATILE COMPOUNDS IN PROCESSING BUN FROM RICE" doc

Danh mục: Báo cáo khoa học

... december 20 06 pp 1533-1536 Varaporn Laksanalamai and Sarath Ilangantileke (1993) Comparision of aroma compound (2acetyl-1-pyrroline) in leaves from Pandan (Pandanus Amaryllifolius) and Thai fragrant ... the pandan leaf and used it as the standard for qualitative and quantitative analysis of 2- AP in aromatic rice and other medicinal plants such as Thien Nien Kien Homalomena aromatica (Phan Phuoc ... 4 /20 11, trang 21 -27 A. B. Nadaf, S Krishnan A. K.Watke (20 06) Histochemical and Biochemical analysis of major aroma compound (2- acetyl-1-pyrroline) in bastami and other scented rice (Oryza Sativa...

8
435
0

Báo cáo khoa học: Probing the substrate speciﬁcities of matriptase, matriptase-2, hepsin and DESC1 with internally quenched ﬂuorescent peptides potx

Danh mục: Báo cáo khoa học

... Pro-urokinase-type plasminogen FEBS Journal 27 6 (20 09) 22 1 322 26 ê 20 09 The Authors Journal compilation ê 20 09 FEBS F Beliveau et al 22 23 24 25 26 27 28 29 30 31 32 33 34 activator is a substrate ... containing Ala at P4 and P3, and Pro at P2, followed by substrates containing Phe and Gly at P3 and P2 Our results showed that DESC1 preferred Leu at P2, Arg Ala Leu at P3, Arg at P4 and Ala at ... most suitable substrate for DESC1 had a basic amino acid FEBS Journal 27 6 (20 09) 22 1 322 26 ê 20 09 The Authors Journal compilation ê 20 09 FEBS 22 17 22 18 15 16 17 18 11 12 13 14 10 Substrate RQAR-VVGG...

14
279
0

Báo cáo khoa học: Mechanisms of amyloid ﬁbril self-assembly and inhibition Model short peptides as a key research tool pptx

Danh mục: Báo cáo khoa học

... Serpell LC (20 05) Molecular basis for amyloid fibril formation and stability Proc Natl Acad Sci USA 1 02, 315– 320 36 Tartaglia GG, Cavalli A, Pellarin R & Caflisch A (20 04) The role of aromaticity, ... important information of the role of aromatic moieties in amyloid fibril formation [36–41] A parameter-free model based on the mathematical analysis of many peptide fragments and their analogues had ... Dyda F, Reed J & Tycko R (20 00) Amyloid fibril formation by A beta 16 22 , a seven-residue fragment of the Alzheimer’s beta-amyloid peptide, and structural characterization by solid state NMR Biochemistry...

8
440
0

Báo cáo Y học: Cytochrome c from a thermophilic bacterium has provided insights into the mechanisms of protein maturation, folding, and stability potx

Danh mục: Báo cáo khoa học

... responsible for stability, and in fact Ala7, Met13, and Tyr43 in HT c-5 52 have been shown, by mutagenesis and 3D structure analyses, to be determinants of the higher stability of HT c-5 52 (see below) ... hyperthermophilic bacterium Aquifex aeolicus Ó FEBS 20 02 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Cytochrome c structure and stability (Eur J Biochem 26 9) 3361 (VF5) Characterization of two highly ... homologous and more stable HT c-5 52 Ó FEBS 20 02 Amino-acid residues responsible for stability As HT c-5 52 and PA c-551 have almost identical mainchain folding [6], subtle differences in the side-chain...

7
369
0