0

would be aimed at students with different levels of language competence from low intermediate to almost native speaker abilities

báo cáo khoa học:

báo cáo khoa học: " Interactions between cauliflower and Rhizoctonia anastomosis groups with different levels of aggressiveness" ppt

Báo cáo khoa học

... abundant stomatal penetration of the AG 1-1B and AG 11C isolates is probably correlated with the aerial nature of these AGs [33], since isolates from foliage have been reported to penetrate stomata ... Relation of calcium content and nature of pectic substances in bean hypocotyls of different ages to susceptibility to an isolate of Rhizoctonia solani Phytopathology 1965, 55(7):734-738 Bugbee ... staining of transversal sections of cauliflower hypocotyls Figure Toluidine blue staining of transversal sections of cauliflower hypocotyls Stomatal penetration at dpi by binucleate Rhizoctonia...
  • 12
  • 271
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Comparison between the structure and function of chloroplasts at different levels of willow canopy during a growing season" ppsx

Báo cáo khoa học

... due to ageing, since the area of plastoglobuli of chloroplast area increased (data not shown), which is known to be an indication of ageing (Hudak, 1981).The pattern of thylakoid organization at ... remained below 1.4 (Fig B) The leaves examined from levels and were physiologically young and the rates of C0 uptake recorded were from intermediate to high (Fig 2A) The ratio of the length of appressed ... Discussion At all studied levels of the canopy, the ratio of the total length of appressed to non-appressed thylakoid membranes was lowest (0.9-1.4) in the youngest leaves (Fig B) that were exposed to...
  • 4
  • 332
  • 0
Tài liệu Reporting Test Results for Students with Disabilities and English-Language Learners ppt

Tài liệu Reporting Test Results for Students with Disabilities and English-Language Learners ppt

Cao đẳng - Đại học

... Aggregated Aggregated Separate Aggregated Aggregated Aggregated Aggregated Separate Aggregated, Separate Aggregated Aggregated Aggregated Aggregated, Separate Aggregated Aggregated Aggregated ... Aggregated Aggregated Other Aggregated Aggregated Aggregated Aggregated Aggregated Aggregated Aggregated Aggregated Aggregated Aggregated Aggregated, Separate Aggregated Aggregated Aggregated ... Aggregated Aggregated, Separate Aggregated Aggregated Aggregated Separate Separate Separate Aggregated Counted Other No Decision Separate Other Aggregated, Separate, Counted Aggregated Aggregated...
  • 103
  • 505
  • 0
Báo cáo khoa học: Two L-amino acid oxidase isoenzymes from Russell’s viper (Daboia russelli russelli) venom with different mechanisms of inhibition by substrate analogs pdf

Báo cáo khoa học: Two L-amino acid oxidase isoenzymes from Russell’s viper (Daboia russelli russelli) venom with different mechanisms of inhibition by substrate analogs pdf

Báo cáo khoa học

... Characterization of avin cofactor (A) UVvisible absorption spectrum between 300 and 600 nm of enzyme-bound cofactor of: (1) the sample obtained from gel ltration chromatography; (2) cofactor separated from ... aromatic amino acids indicated that the aromatic ring offers a better t at the substrate-binding site Therefore, to analyze the roles of different parts of the inhibitor, a set of good substrate ... from NH2 to the a-C atom, which activates the substrate to transfer the hydride from a-C to N-5 of the avin moiety to yield the imino acid and FADH2 [11] The structure of the catalytic site of...
  • 18
  • 306
  • 0
Báo cáo Y học: The inhibitory region of troponin-I alters the ability of F-actin to interact with different segments of myosin pot

Báo cáo Y học: The inhibitory region of troponin-I alters the ability of F-actin to interact with different segments of myosin pot

Báo cáo khoa học

... reversion of the signal lineshape to that of the free peptide is found to saturate at close to a : molar ratio In the presence of tropomyosin, saturation occurred at a lower peptide : actin ratio ... concentration of actin was in each case was 40 lM with < 5% dilution during titration with the inhibitory peptide up to a concentration of 160 lM, pH 7.2 Saturation of the linewidth change at lower ... kinetics of binding of the human cardiac TnI128–153 inhibitory peptide to immobilized F-actin at the peptide concentrations indicated The fit of these data to : complex formation yielded a dissociation...
  • 13
  • 524
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "DEDUCTIVE PARSING WITH MULTIPLE LEVELS OF REPRESENTATION*" pptx

Báo cáo khoa học

... components of that node's category label, and hence are invisible to other principles of grammar Thus this formulation imposes an informational encapsulation of the principles of grammar that the ... associating each node with one of the three atomic values ass, rec or These values represent the Case properties of the node they are associated with; a node associated with the property ass must be ... between these two components of a human's knowledge of a language and the knowledge of the utterances of that language that they induce can be formally described as follows: we regard Universal...
  • 8
  • 269
  • 0
báo cáo hóa học:

báo cáo hóa học:" Assessment of ultrasonographic features of polycystic ovaries is associated with modest levels of inter-observer agreement" pot

Hóa học - Dầu khí

... these features are used to diagnose polycystic ovaries, we believe each of these features should be evaluated at the time of ovarian ultrasonography since each relates to an important aspect of ovarian ... employed the equation for a prolate spheroid, rather than the commonly used equation of a prolate ellipsoid, since this method was found to correlate better with volume measurements of polycystic ... extent to which any of the ultrasound criteria contributed to the subjectivity of the diagnosis was not assessed and to date, we are unaware of any other study that has attempted to further evaluate...
  • 9
  • 282
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Effect of β -mercaptoethanol or epidermal growth factor supplementation on in vitro maturation of canine oocytes collected from dogs with different stages of the estrus cycle" ppsx

Báo cáo khoa học

... times in the bench medium to wash off blood and other debris prior to transfer to maturation medium Removal of cumulus cell and assessment of meiotic stage At the end of the maturation culture, ... ovariohysterectomy at private clinics, placed immediately into physiological saline solution (PSS) at 37oC and transported back to the laboratory within h Ovaries were removed from the tract ... investigated the effect of βME or EGF supplementation on the base of the stages of the estrus cycle of the ovaries, and demonstrated that β-ME or EGF supplementation significantly increased maturation...
  • 6
  • 250
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Height growth, shoot elongation and branch development of young Quercus petraea grown under different levels of resource availability" pptx

Báo cáo khoa học

... shorter periods of time A consequence is that variations in annual shoot elongation were more related to variations in the number of flushes than to variations in the number or the length of the internodes ... changes in the location of the longest GU did not seem to be related to the number of growth flushes produced nor to the treatment Within a growing season the longest GUs could change between two or ... the first flush were also associated with a different relationship between the number of internodes and GU length Death of the apical bud The frequency of the death of the resting apical buds was...
  • 17
  • 240
  • 0
Báo cáo y học:

Báo cáo y học: "Polymorphism in the tumour necrosis factor receptor II gene is associated with circulating levels of soluble tumour necrosis factor receptors in rheumatoid arthritis" ppsx

Báo cáo khoa học

... sTNFRs and levels of these receptors released from isolated T cells (Table 5) The circulating levels of each sTNFR were strongly correlated with levels released by both unstimulated and stimulated ... correlation between serum levels of soluble tumour necrosis factor receptor (sTNFR) and levels released by isolated T cells from rheumatoid arthritis (RA) patients (n = 58) Spearman correlation ... of sTNFRs, according to genotype, by isolated T cells from RA patients We also demonstrated that the levels of sTNFR released by T cells in vitro are very closely correlated with the levels of...
  • 8
  • 390
  • 0
Báo cáo y học:

Báo cáo y học: "Neutrophils exhibit distinct phenotypes toward chitosans with different degrees of deacetylation: implications for cartilage repair" pdf

Báo cáo khoa học

... inhibition of migration corresponds to the fluorescence of PMNs incubated with the inhibitors that migrated toward 80 M chitosan versus fluorescence of PMN incubated in media that migrated toward ... degree of deacetylation is an important factor to consider in the use of chitosan as an accelerator of repair because PMNs exhibit a differential capacity to migrate towards 80 M and 95 M chitosan ... chitosan to attract PMNs but also indicated that the degree of acetylation of chitosan affected its chemotactic activity toward PMNs Mediator(s) of the chemotactic effect of 80 M and 95 M chitosan...
  • 10
  • 414
  • 0
báo cáo khoa học:

báo cáo khoa học: " Gene expression analyses in maize inbreds and hybrids with varying levels of heterosis" ppt

Báo cáo khoa học

... slightly towards the low parent We suspected that the slight deviation of d/a type I values from the mid-parent levels may be caused by technical rather than biological factors We found that genes with ... Validation of differential expression using MassArray and 70-mer platforms Validation of differential expression using MassArray and 70-mer platforms The magnitude of differential expression between ... possibility that the different sets of genes represented on either platform may result in different rates of non-additive profiles To address this, we generated a d/a plot (type I) of the 70-mer...
  • 19
  • 316
  • 0
Báo cáo y học:

Báo cáo y học: "Alterations in the muscle-to-capillary interface in patients with different degrees of chronic obstructive pulmonary disease" pps

Báo cáo khoa học

... decreased number of capillaries/muscle fibre (CAF) in patients with COPD [8,9,13] However, it is important to highlight the fact that the ratio between the number of capillaries and the area of muscle ... Eliason et al Respiratory Research 2010, 11:97 http://respiratory-research.com/content/11/1/97 Page of mitochondrial respiratory function in patients with COPD [12] Furthermore, three ... (CFPEindex) can be calculated as the quotient C:Fi and fibre perimeter [19] As CFPE-index has been shown to be correlated to precise stereological methods it can be used to assess muscle fibre -to- capillary...
  • 7
  • 317
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Regulation of the erm(C) Gene in Staphylococci from Reservoir with Different Usage of Macrolides" docx

Báo cáo khoa học

... CGTTAATAAGCAAAATTCATTATAACCAAATTAAAGAGGGTTATAATGAA CGTTAATAAGCAAAATTCATTATAACCAAATTAAAGAGGGTTATAATGAA CGTTAATAAGCAAAATTCATTATAACCAAATTAAAGAGGGTTATAATGAA CGTTAATAAGCAAA TTAAAGAGGGTTATAATGAA ... ATCAGCACAGTTCATTATCAACCAAACAAAAAATAAGTGGTTATAATGAAT ATCAGCACAGTTCATTATCAACCAAACAAAAAATAAGTGGTTATAATGAAT ATCAGCACAGTTCATTATCAACCAAACAAAAAATAAGTGGTTATAATGAAT ATCAGCACAGTTCATTATCAACCAAACAAAAAATAAGTGGTTATAATGAAT ... ACTAATTTTATAAGGAGGAAAAAATATGGGCATTTTTAGTATTTTTGTA ACTAATTTTATAAGGAGGAAAAAATATGGGCATTTTTAGTATTTTTGTA ACTAATTTTATAAGGAGGAAAAAATATGGGCATTTTTAGTATTTTTGTA ACTAATTTTATAAGGAGGAAAAAATA ACTAATTTTATAAGGAGGAAAAAATA ACTAATTTTATAAGGAGGAAAAAATA...
  • 4
  • 248
  • 0
Báo cáo y học:

Báo cáo y học: " Maximal respiratory static pressures in patients with different stages of COPD severity" potx

Báo cáo khoa học

... associated with decreased respiratory strength [18] To conclude, when we treat a patient with severe airflow obstruction we should consider the possible respiratory muscle deterioration that could ... Respiratory Research 2008, 9:8 http://respiratory-research.com/content/9/1/8 (MEP) measures the maximum positive pressure that can be generated from one expiratory effort starting from total ... [10-12] The factors contributing to respiratory muscle weakness in many patients with COPD are: a) malnutrition related to biochemical, anatomical and physiological changes; b) muscular atrophy; c)...
  • 7
  • 323
  • 0
Báo cáo y học:

Báo cáo y học: " Susceptibility to ozone-induced airway inflammation is associated with decreased levels of surfactant protein D" pdf

Báo cáo khoa học

... appears to be associated with different levels of SP-D C57BL/6 mice that express high levels of SP-D also produce high levels of the anti-inflammatory cytokine IL-10 and high levels of IL-6 In contrast, ... control) levels of SP-D are associated with the resolution of the O3induced inflammation and low levels or lack of SP-D predispose to a severe inflammatory response The drop in SP-D levels seen ... significant elevation of SP-D levels with approximately 50 % increase from baseline 12 hrs post-exposure SP-D continued to increase Page of (page number not for citation purposes) Respiratory Research...
  • 9
  • 378
  • 0
Báo cáo y học:

Báo cáo y học: "Semen-mediated enhancement of HIV infection is donor-dependent and correlates with the levels of SEVI" docx

Báo cáo khoa học

... high cytotoxicity (C) Virus stocks of R5 HIV-1 treated with the indicated concentrations of SE were used to infect TZM-bl cultures adjusted to the indicated pH values After two hours of virus ... stocks adjusted to the indicated pH values were either treated with PBS or with various concentrations of SE and subsequently used to infect TZM-bl indicator cells (E) TZM-bl cells were incubated ... show that the confounding effects of cytotoxic factors in SE can largely be overcome by (i) pre-treating the virus rather than the cells; (ii) using a small volume of SEtreated virus stocks to infect...
  • 12
  • 332
  • 0
Báo cáo y học:

Báo cáo y học: "Characterization of HIV-1 subtype C envelope glycoproteins from perinatally infected children with different courses of disease" ppsx

Báo cáo khoa học

... Replication of viral isolates from rapid and slow progressors Replication of viral isolates from rapid and slow progressors in PBMC Panel A shows the replication properties of the last viral isolates ... and putative glycosylation sites The number of putative N-linked glycosylation sites (PNGS) and Env domain length have been hypothesized to modulate HIV-1 sensitivity to neutralization and to impact ... it is unlikely that rapid progression is due to receipt of lower maternal Nab, or that slow progression is due to acquisition of high level of maternal Nab or the development of a higher or more...
  • 15
  • 208
  • 0
Interaction between the elements with different degrees of smallness in nonlinear oscillating systems

Interaction between the elements with different degrees of smallness in nonlinear oscillating systems

Cao đẳng - Đại học

... o f parametric excitation will exist even with the absence o f forced one Some related can be found in publications [2- 6] listed below w ledgm ents Fhe author is srateful to Dr Tran Thi Kim Chi ... / from equations (2.7) and the further discussion will be th esam e as in the paragraph teraction between the elem ents characterizing the parametric and xcita tions with different degrees of ... corresponds to the stability o f stationary solution where the inequalities (3.16) are L It is easy to prove that the trivial solution 11=0 of the equations (3.8) is unstable nteraction between metric...
  • 10
  • 251
  • 2
Interaction between the forced and parametric excitation with different degrees of smallness

Interaction between the forced and parametric excitation with different degrees of smallness

Cao đẳng - Đại học

... sta b le state an d to an u n stab le one if M fro m a regio n w > to a region w < O n the c o n tra ry , if < 0, then the p o in t of in te rse ctio n ponding to a sta b le sta te of o s c illa ... (d o ,cư) into re g io n s, w hag a d e fin ite sig n ( + or 16 —) If m o v in g ill each of up a lo n g the it lin e p a r a lle l to tlie a x is d o , we pass from a region w < to a reg io ... s )enoti Iig c = A + — - D = — ,H = hw , -P a l, ( ) ve the following equations for stationary values do, 00 satisfying the relations: dZ - = d dt = dt 0; ' / = „ = J y 0, ( 2 ) v ' / = H a +...
  • 7
  • 244
  • 1

Xem thêm