work in pairs discuss which of the jobs in column a you would would not like to do explain why why not you can use the cues in column b c

Luận văn Discuss some of the most prominent aspects of the culture and society of the mainstream American in the twentieth and twentyfirst centuries

Ngày tải lên : 26/05/2016, 14:13

... fact explains why literary works against wars usually deal with children and their anxiety In another story named Snow by the DominicanAmerican fiction writer Julia Alvarez, we, again, come across ... American society, there are many races such as white, black or African-American, American Indian or Alaska native, Asian, native Hawaiian, other Pacific Islander and ethnic groups due to immigrations ... character in dramatic scenes, in moments of action, and in exchanges of dialogue.” From the scenes, the moments of action and what the characters speak to each other, the readers can understand...

47
532
0

GMAT OFFICIAL GUIDE th 10 Edition 1 CRITICAL REASONING 1. Which of the following best completes

Ngày tải lên : 17/10/2013, 15:15

... rise because of growing trade deficits and trade can be balanced by means of a decline in a country’s standard of living If the facts stated in the passage above are true, a proper test of a country’s ... thousand members of each group rather than comparing total numbers of deaths E Comparing deaths caused by accidents in the United States to deaths caused by combat in the armed forces 17 Toughened ... B The anopheles mosquito, which is the principal insect carrier of the malarial parasite, has been eradicated in many parts of the world C Many malarial symptoms other than the fever, which can...

25
726
0

Báo cáo khoa học: Identiﬁcation and expression of the ﬁrst nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt

Ngày tải lên : 16/03/2014, 16:20

... 5¢-CCATCCTAATAC GACTCACTATAGGGC-3¢ and gene speci c reverse primer 5¢-CAGCAAGTACGTGGTGGTAATGACGG-3¢ (obtained from an EST database sequence presumably corresponding to a partial Xenopus APLP2 cDNA; ... features not present in the other members of the APP superfamily, such as the absence of the exon encoding the KPI domain and the lack of a second heparin-binding domain [3,4,13,26] Comparative analysis ... 5¢-GATGAAGTTGTAGAAGACCGTGACTAT TA-3¢ and reverse primer 5¢-GTGGTGCCGAACCTC TAGTTG-3¢ were used to examine the presence of exon 7; to study the presence of exon 14, forward primer 5¢-AGA GTCCCAGGGCGATGTAA-3¢...

7
405
0

Báo cáo khoa học: Role of CCP2 of the C4b-binding protein b-chain in protein S binding evaluated by mutagenesis and monoclonal antibodies docx

Ngày tải lên : 17/03/2014, 09:20

... C4 BP b- chain CCP1-2 (B) (A) C4 BP consists of seven identical a- chains and one b- chain Each chain is made up repeating complement control protein (CCP) domains The a- chains have eight such CCP domains, ... First, the effect of increasing amounts of ﬂuid phase protein S on the binding of the MoAbs to immobilized recombinant b- chain was tested The binding of both MoAb 15 and MoAb 44 to the b- chain was ... suggested b- chain CCP2 to have a speci c positive in uence To further evaluate the role of b- chain CCP2 in the interaction with protein S we decided to introduce amino acid changes into putative binding...

8
389
0

Báo cáo khoa học: Deviation of the neurosporaxanthin pathway towards b-carotene biosynthesis in Fusarium fujikuroi by a point mutation in the phytoene desaturase gene ppt

Ngày tải lên : 30/03/2014, 01:20

... to cDNA synthesis as described above Two microlitres of the cDNA were then used for ampliﬁcation of al-2 using the primers 5¢-TCC AAGCTTCTATATGACAATAGCGCC-3¢ and 5¢-CCAG GATCCGTCTACTGCTCATACAAC-3¢, ... niaD4 niaD4 niaD4 SF215 niaD4 carS63 carB36 SF216 niaD4 carS63 carB+ a Origin + carS35 carB+ carS35 carB36 carS35 carB37 carS35 carB38 carB+ ⁄ carB36 hygR carS63 carB+ ⁄ carB36 hygR carS63 carB36 ... following the manufacturer’s instructions Two microlitres of cDNA were used for the ampliﬁcation of carB using the primers 5¢-ATGAGCGACATTAAGAA ATCTG-3¢ and 5¢-CTAATTCGCAGCAATGACAAG-3¢ The PCR was performed...

16
440
0

– ACT SCIENCE REASONING TEST PRACTICE – 48. Which of the objects represented on Graph I is ppt

Ngày tải lên : 18/06/2014, 17:20

... folding process, what can be said about the amino acids of the molecular chaperonin that come in contact with the unfolded protein? f The amino acids in the molecular chaperonins are hydrophobic ... g The amino acids in the molecular chaperonins are hydrophilic h The amino acids in the molecular chaperonins are both hydrophobic and hydrophilic j The amino acids in the molecular chaperonins ... vertically downward Accuracy The closeness of an experimental measurement to the accepted or theoretical value Acid A substance that is a proton donor The pH of an acid is less than Analysis A stage...

29
635
0

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Ngày tải lên : 26/10/2012, 10:04

... 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to- 895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The PCR products were purified using a Microcon 100 column (U.S Amicon Inc Beverly, ... Characteristics of study participants Biochemical analysis Plasma total cholesterol concentrations, as well as serum creatinine and uric acid concentrations, were measured using standard methods in the Clinical ... Cardiac fibrosis in mice lacking brain natriuretic peptide Proc Natl Acad Sci USA 2000; 97: 4239-44 Mukoyama M, Nakao K, Saito Y, et al Human brain natriuretic peptide, a novel cardiac hormone Lancet...

7
612
1

Báo cáo khoa học: Broad antibiotic resistance proﬁle of the subclass B3 metallo-b-lactamase GOB-1, a di-zinc enzyme potx

Ngày tải lên : 14/03/2014, 23:20

... (5Â-GCACCTGTATGGTCGTAGTGAGCCGCAGTAAG CAGC-3Â) For the Q116N mutant forward and reverse: (5Â-GATCTTGCTGCTTACTAACGCTCACTACGACC ATACAGG-3Â) (5Â-GCACCTGTATGGTCGTAGTGAGCGTTAGTAAG CAGC-3Â) For the Q116H ... mutant forward and reverse: (5Â-GATCTTGCTGCTTACTCATGCTCACTACGACC ATACAGG-3Â) (5Â-GCACCTGTATGGTCGTAGTGAGCATGAGTAA GCAGC-3Â) Production and purication of the zinc b- lactamase LB medium (100 mL) containing ... (5Â-GGGGGGGGATCCATGAGAAATTTTGCTA CACTGTTTTTCATG-3Â) and (5Â-CCCCCCCTCGAGTTA TTTATCTTGGGAATCTTTTTTTATTTTGTC-3Â), where the restriction sites generated are underlined The PCR conditions were: incubation at 95 C for...

12
406
0

Báo cáo khoa học: High-resolution NMR studies of the zinc-binding site of the Alzheimer’s amyloid b-peptide pdf

Ngày tải lên : 23/03/2014, 10:20

... more affected by zinc binding (both intensity and chemical shift) than are the Cb crosspeaks (data not shown) The reason could be that Ca is closer than Cb to the binding site, suggesting zinc binding ... Danielsson et al constant calculated here is not a quantitative measure of binding of zinc by the molecule, but rather a measure of which residues are most involved in the binding Such an apparent ... 1 3C HSQC, and can be interpreted in the same terms as speci c binding of the metal in the N-terminal part of the peptide These observations conﬁrm that the zinc-binding site is in the N-terminus,...

14
355
0

Báo cáo Y học: Novel regulatory regions found downstream of the rat B29/Ig-b gene docx

Ngày tải lên : 24/03/2014, 03:21

... mouse and human beta-globin loci: the beta-globin genes are embedded within an array of odorant receptor genes Proc Natl Acad Sci USA 96, 5129–5134 34 Hebbes, T.R., Clayton, A. L., Thorne, A. W ... of human glyceraldehyde 3-phosphate dehydrogenase cDNA (GraP-DH Clontech, Palo Alto, CA, USA) according to the manufacturer’s instructions Cosmid clones possessing the rat B2 9/GH locus have been ... of the B2 9/Ig -b gene has been studied by analyzing cis-elements located as far as the 1.2-kb upstream region and their interacting transcription factors During B- cell development, B- cell-speciﬁc...

10
332
0

Why the User Experience of Enterprise Software sucks and what you can do about it

Ngày tải lên : 03/06/2014, 18:29

... WORLDWIDE Source: OF THESE PROJECTS ARE ABANDONED EACH YEAR FOR A VARIETY OF REASONS Source: IT COSTS TWICE AS MUCH TO FIX A PROBLEM AFTER A PROJECT THAN IT WOULD HAVE DURING THE PROJECT Source: FORRESTER ... read an article in which a car magazine modified the “sports” model of some production car to get the fastest possible standing quarter mile You know how they did it? They cut off all the crap ... (SHORT) STORIES A user should be able to upload a picture of their cat GET OUT OF THE OFFICE, AND DO FIELDWORK COMMUNICATING DESIGN IS IMPORTANT THE DEFAULT ANSWER SHOULD BE NO A few years ago...

53
412
1

The Project Gutenberg EBook of The GoGetter, by Peter B. Kyne ppt

Ngày tải lên : 28/06/2014, 17:21

... forced us into the position of having to fire folks by cable Why? Because we're breaking into a game that can' t be played on the home grounds A lot of our business is so far away we can' t control ... own?" "Of course not I'm boss of the Blue Star Navigation Company, am I not? The man was in charge of the Shanghai office before you ever opened your mouth to discharge your cargo of free advice." ... firing me I'm not an object of charity, but I'm scarcely the man I used to be and I'm four years behind the procession and have to catch up I have the best of references " "I see you have," Cappy...

134
264
0

LX Thuy_tính toán vỏ có lỗ giảm yếu và gân gia cường chịu sóng xung kích: Effect of Some Factors on the Dynamic Response of Reinforced Cylindrical Shell with a Hole on Elastic Supports Subjected to Blast Loading

Ngày tải lên : 02/11/2016, 22:48

... However, the shell uses the elastic seat connection, so when the stiffness of the shell increases making more load transfers to the elastic seating which leads to the increase of the total displacement ... various values of hg Comment: In the examined value range of hg, while increasing hg, stresses σx, σy at the calculated point reduce nonlinearly The displacement at the initial calculated point ... preserving the opening angle of the shell and other parameters, increasing the radius r will increase the displacement and stress at the calculated point At this time, the vibration of the structure...

8
772
0

402Part II: SQL and SQL*PlusWithin the into table clause, you can use the recnum keyword to pps

Ngày tải lên : 07/08/2014, 14:20

... is complete A database link can be private, owned by a single user, or public, in which case all users in the Local database can use the link The syntax for creating a database link is shown in ... require the authenticated by clause In this example, the account used for authentication is an application account, but you can also use an empty schema for authentication The authentication account ... replicated to a local table, you can use the on prebuilt table clause to tell Oracle to use that table as a materialized view NOTE You can specify the storage parameters to be used for the index...

105
472
0

BÀI LUẬN TIẾNG ANH HAY describe what you think it would be like to spend some time on the moon

Ngày tải lên : 20/08/2015, 00:38

1
721
0

How group work is used in speaking lesson of the first year major students of english at viet nam university of commerce

Ngày tải lên : 07/11/2012, 14:50

... 33.3% claimed that their lack of academic training in group work management and teaching experience caused the difficulties to their application of group work in speaking class In respect of another ... Language Teaching (CLT) marks the beginning of a major innovation within language teaching for its widely accepted principles CLT is now regarded as an approach which aims to make communicative competence ... popularly applied to language teaching and learning, especially, to speaking skill learning for its many advantages Yet, the teacher also need to aware of some drawbacks that may arise in the process...

42
1.9K
4

136 Best Models Essays - Discuss the role of the police force in society

Ngày tải lên : 25/10/2013, 05:20

22
618
1