with innovative material selection sensible construction techniques and modern aesthetics one can craft a unique design language that sets a new standard
101 Trích dẫn hay về thiết kế
... design is all about details With innovative material selection, sensible construction techniques and modern aesthetics one can craft a unique design language that sets a new standard — Roi James Simplicity, ... imagination is like a teabag without hot water — Alan Fletcher A man who works with his hands is a laborer; a man who works with his hands and his brain is a craftsman; but a man who works with ... his hands and his brain and his heart is an artist — Louis Nizer A great trademark is appropriate, dynamic, distinctive, memorable and unique — Primo Angeli Great designers seldom make great advertising...
- 19
- 534
- 2
Gà Tò! An mỹ Quỳnh phụ Thái bình
... Quốc gia tiến hành kiểm định kết luận: Gà Tò vật nuôi quý hiếm, nằm danh mục bảo tồn nguồn gene quốc gia V a qua, huyện Quỳnh Phụ triển khai đề tài “Xây dựng mô hình tuyển chọn nuôi gà Tò xã An Mỹ” ... loại gà ta bán 60.000đ/kg mà thôi”, anh Cảnh cho biết Mỗi lần, gà Tò đẻ 14 - 15 trứng Sau cho ấp nuôi thời gian, anh Cảnh chọn 2- ưng ý, to đẹp đàn nuôi riêng để tiếp tục lai tạo, số lại mang hủy ... trưng gà Tò ch a cao, to lắm” Bắt gà lên, anh bảo, đặc trưng gà Tò có lông suốt từ khuỷu chân xuống, gọi “lông quần” Ph a sau gối gà trống có thêm chòm lông đuôi quạ, gọi “lông gối” Anh khẳng định...
- 6
- 1,025
- 2
Configure Routing between the RSM and an External Router Connected to an ISP
... access layer switch ALSwitch Switch#show vlan Switch#show vtp stat Clear your NVRAM and reload Switch#clear start Switch#reload Now check VLAN and VTP information again Switch#show vlan Switch#show ... using ALSwitch#show run g Configure VLAN1 management interface IP address and default gateway for the switch ALSwitch(config)#ip default-gateway 10.1.1.1 ALSwitch(config)#interface VLAN1 ALSwitch(config-if)#ip ... simple NAT for the address translation from private to public (real world), and also EIGRP to establish default route and network communication to the DLRouter Everything else is fairly standard...
- 13
- 374
- 0
Connecting to an Access Databasefrom ASP.NET
... needs Read, Write, Execute, Delete, and Change permissions on the folder containing the database files The user account requires permissions to access the share that contains the database file and ... configured Configure the Access server On the Access computer, the user account that is used to access the database requires Read, Write, Execute, and Change permissions on the database file The user ... duplicate account on the Access computer with the same name and password Grant the user account Log on Locally and Access this Computer from the Network permission to access the computer in the local...
- 2
- 359
- 0
Tài liệu Converting a DataSet to an ADO Recordset docx
... // Load the Orders data into a table in a DataSet DataSet ds = new DataSet( ); SqlDataAdapter da = new SqlDataAdapter(sqlText, ConfigurationSettings.AppSettings["Sql_ConnectString"]); da.Fill(ds, ... Load the ADO recordset into a DataTable OleDbDataAdapter oleDa = new OleDbDataAdapter( ); DataTable dt = new DataTable("Orders"); oleDa.Fill(dt, rs); // Bind the default view of the table to the ... ""; xmlDoc.LoadXml(adoXml); // Create a namespace manager for the XML document XmlNamespaceManager nm = new XmlNamespaceManager(xmlDoc.NameTable); // Add ADO prefixes nm.AddNamespace("s", "uuid:BDC6E3F0-6DA3-11d1 -A2 A3-00AA00C14882");...
- 15
- 390
- 0
Tài liệu Connecting to an ODBC Data Source ppt
... object that appears The NET ODBC data provider requires a reference to the System.Data.Odbc namespace in NET Framework Version 1.1 In Version 1.0, the namespace is Microsoft.Data.Odbc Add a NET ... within MSDN Library Visual Studio also supports creating ODBC data source connections visually: • • Create a data connection in Server Explorer and drag it onto a form or design surface Configure ... surface Configure the OdbcConnection object that appears in the component tray Drag an OdbcConnection from the Data tab of the Toolbox onto a form or design surface Configure the ConnectionString property...
- 3
- 495
- 0
Tài liệu Connecting to an Oracle Database docx
... Oracle8 Release 8.0 or later and requires the Oracle9i Client Release (9.2) or later Here are desciptions of available managed providers: • Oracle has released a NET data provider It is available ... data provider should be used primarily as a bridge from applications that already use ODBC Use a native Oracle NET data provider where practical TNSNAMES.ORA Oracle uses a configuration file named ... providers because they are built specifically for the database and because they remove a layer of indirection from the application to the database OLE DB You can use the OLE DB NET data provider with...
- 5
- 418
- 0
Tài liệu Edit Data and Update Changes That Are Made to an ADO.NET pdf
... then called to complete the editing of the DataRow A CommandBuilder object is created to create the Update command for the DataAdapter object The DataAdapter Update method is called to update the ... update the dataset with the data changed and then the AcceptChanges of the DataSet object This accepts all the changes for all the objects and posts the data back to the server Finally, the connection ... Create the LoadList routine by entering the following code into the form you created for this How-To This code creates and fills a data table using a data adapter The string that the data adapter...
- 10
- 400
- 0
Tài liệu Exporting the Results of a Query to an Array pdf
... SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable dt = new DataTable(ORDERS_TABLE); da.Fill(dt); StringBuilder sb = new StringBuilder( ); Array ... (rowCount >= 0) nRows = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection ... = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and rows selected...
- 5
- 309
- 0
Tài liệu Báo cáo khoa học: Exposure of IgG to an acidic environment results in molecular modifications and in enhanced protective activity in sepsis doc
... plates were washed and further incubated with an alkaline phosphatase-conjugated goat anti-mouse IgG2b (PharMingen, San Diego, CA, USA) for h at room temperature The following steps of the assay ... fragments of IVIg (A) and to pooled human IgM (B), but not to Fc-c (C) or Fc-l fragments (D), as assessed by ELISA Data represent mean absorbance values ± standard deviation of quadruplicate wells (solid ... Stratis Avrameas suggesting that polyreactive antibodies may represent a buffering system that prevents brisk changes in the levels of components of inflammation, coagulation, and other pathways [21]...
- 12
- 620
- 0
Tài liệu Báo cáo khoa học: Regulation of dCTP deaminase from Escherichia coli by nonallosteric dTTP binding to an inactive form of the enzyme ppt
... data collection and processing (Sawyer L, Isaacs N & Bailey S, eds) pp 114–122 Daresbury Laboratory, Warrington, UK 35 Navaza J (1994) AMoRe: an automated package for molecular replacement Acta ... most favoured regions and Ala121 and Val122 form a cis-peptide that puts them in the generously allowed and disallowed regions, respectively, of the Ramachandran plot Acknowledgements We are grateful ... Experimental procedures Materials All buffers, nucleotides and salts were obtained from Sigma-Aldrich (Darmstadt, Germany) Radioactive nucleotides were obtained as ammonium salts from Amersham Biosciences...
- 11
- 577
- 0
Tài liệu Báo cáo khoa học: Lipopolysaccharide-evoked activation of p38 and JNK leads to an increase in ICAM-1 expression in Schwann cells of sciatic nerves ppt
... intercellular adhesion molecule Proc Natl Acad Sci USA 91, 11641–11645 Roebuck KA, Rahman A, Lakshminarayanan V, Janakidevi K & Malik AB (1995) H2O2 and tumor necrosis factor-alpha activate intercellular ... min, and then stimulated with lgÆmL)1 LPS for h Cells were harvested for semi-quantitative RT-PCR analysis, and representative blots are shown Data were normalized against GAPDH and are plotted as ... Gram-negative bacteria, and its recognition and signal transmission are key events in the host defense reaction towards Gram-negative bacteria Generally, LPS activates monocytes and macrophages...
- 11
- 519
- 0
Wind tunnel and propulsion test facilities supporting analyses to an assessment of nasa docx
... Defence National Aeronautics and Space Administration National Aerospace Plane National Aeronautic Test Alliance Naval Air Systems Command National Full-Scale Aerodynamics Complex National Transonic ... the very valuable suggestions, questions, and observations from our reviewers, Frank Camm and Jean Gebman xix Abbreviations 16S 16TT ASC AEDC AFB AFRL AFSOR AIAA APTU ASE ASTF ATD ATT BMAR BVWT ... Number of New Aircraft Designs Reaching First Flight: 1950–2009 (estimated) 60 New civilian aircraft New military aircraft 50 Number of new designs UAVs Major military remanufacturings and upgrades...
- 164
- 425
- 0
Báo cáo khoa học: "Exploring Deterministic Constraints: From a Constrained English POS Tagger to an Efficient ILP Solution to Chinese Word Segmentation" ppt
... words are generated with respect to the partially tagged character sequence A character tagged with B always occurs at the beginning of a possible word Table illustrates the constrained and raw ... 47th Annual Meeting of the ACL and the 4th International Joint Conference on Natural Language Processing of the AFNLP, ACL ’09, pages 513–521 Mitch Marcus, Beatrice Santorini, and Mary Ann Marcinkiewicz ... model as Our baseline model, which uses Ratnaparkhi (1996)’s feature set and conducts a beam (=5) search in the unconstrained space, achieves a tagging accuracy of 97.16% Tagging accuracy is measured...
- 9
- 425
- 0
Báo cáo Y học: Amphipathic property of free thiol group contributes to an increase in the catalytic efficiency of carboxypeptidase Y pot
... Foster City, CA, USA DEAE-Sephadex A- 50 was from Pharmacia Fine Chemicals, Uppsala, Sweden Hydroxylapatite gel was purchased from Bio-Rad, Hercules, CA, USA Bistris was obtained from Nacalai Tesque, ... enzymes MATERIALS AND METHODS Materials Cbz-Phe-Leu-OH was obtained from Fluka Chemie AG, Buchs, Switzerland Cbz-Ala-Phe-OH was from Sigma Chemical Company, St Louis, MO, USA Cbz-Gly-Phe-OH and Cbz-Gly-Leu-OH ... Kyoto, Japan All other chemicals were of reagent grade and obtained locally Strains and plasmid DNA The plasmid pTSY3 containing the PRC1 gene coding for carboxypeptidase Y and S cerevisiae SEY2202...
- 6
- 459
- 0
Wind Tunnel and Propulsion Test Facilities - Supporting Analyses to an Assessment of NASA pot
... Defence National Aeronautics and Space Administration National Aerospace Plane National Aeronautic Test Alliance Naval Air Systems Command National Full-Scale Aerodynamics Complex National Transonic ... the very valuable suggestions, questions, and observations from our reviewers, Frank Camm and Jean Gebman xix Abbreviations 16S 16TT ASC AEDC AFB AFRL AFSOR AIAA APTU ASE ASTF ATD ATT BMAR BVWT ... Number of New Aircraft Designs Reaching First Flight: 1950–2009 (estimated) 60 New civilian aircraft New military aircraft 50 Number of new designs UAVs Major military remanufacturings and upgrades...
- 164
- 425
- 0
One Year to an Organized Life doc
... where a busy mom and dad are trying to keep track of multiple afterschool programs, parties, and social invitations, a large, centrally located wall calendar can be the best way to keep everyone abreast ... professional dancer Their reaction mirrored that of my parents: Get a real idea Instead of becoming a dancer, she became an acupuncturist and a doctor of Oriental medicine, with a large and successful ... with business, fam- ily, and social demands In fact, my business demands are so overwhelming and all-encompassing that I no longer spend quality time with my family and my friends are up in arms...
- 303
- 248
- 0
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc
... GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC CGGCGCCAGTAGCCGACGAAG CGGGTGGCCGCCAAACTCG AGGAAGCGCGGTCAAGGGAGTCTC CGCAAGGCGCTGGCCGAGTTCA TGTGCAGCAGCGGGACGTAGTAGG GGAATTCCGCGCGCGGGTCTGGCTTCA ... hybridization of ScaIdigested DNA A hybridization band of 4200 bp was obtained for the wild-type with a desA fragment (1372 bp) as probe, and a band of about 4220 bp was found for the mutant with aac(3)IV ... [3] and distributed into 500mL flasks (washed with 10% nitric acid and autoclaved) CaCl2Æ2H2O (0.01% final concentration) and glucose (2.5 gÆL)1 final concentration), autoclaved separately, and...
- 13
- 456
- 0
Báo cáo khoa học: The retinoid-X receptor ortholog, ultraspiracle, binds with nanomolar affinity to an endogenous morphogenetic ligand pptx
... ethyl acetate in hexane Individual peaks were collected and analyzed by GC-MS and NMR Data obtained were compared with spectral data available in the literature or with data generated from the analysis ... methyl farnesoate from the larval ring gland of higher (calypterate) Diptera [21], and from the corpora allata of adult calypterate Diptera [21,22] As with vertebrates and RA, several hydroxylated ... RARa It was postulated that a synthetic ligand that extends into that empty space in RARa would enable selectivity for binding to RARa, but not RARc, and such a synthetic ligand was in fact identified...
- 14
- 199
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25