with a little help from my friends sang by the beatles lyrics
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
Ngày tải lên :
20/02/2014, 02:21
... proteases of
the coagulation system including thrombin (factor
IIa) and factors IXa, Xa, XIa and XIIa. The princi-
pal targets of the serpin are usually regarded as being
thrombin and factor Xa, although ... immediate and medium term future.
Acknowledgements
This work was supported by the National Health &
Medical Research Council of Australia, the Austra-
lian Research Council, the National Heart ... bond cleavage appears to be arrested at the
acyl intermediate by the unique action of the serpin,
whereby the RCL of the serpin inserts into the major
A b -sheet causing the protease to be rapidly...
- 10
- 668
- 0
With a Little Help pptx
Ngày tải lên :
06/03/2014, 14:20
... lit by candles and
draped with gathered curtains that turned the walls into the proscenia of
a grand and ancient stage. There were four or five small tables and a
long one at the back of the ... either," said a voice at his side. I used to change
for the F Train there every day when I was a kid." It was a woman, about
the same age as Gerta, but more beaten down by the years, ... the neat stitching that ran the bind-
ing and the spine, holding together the nylon and the denim, taken from
a pair of jeans, a backpack. The end-papers were yellowed page three
girls from the...
- 282
- 494
- 0
Preliminary organic compound analysis of microparticles returned from Asteroid 25143 Itokawa by the Hayabusa mission pot
Ngày tải lên :
28/03/2014, 20:20
... (1979) Amino
acids in the Yamato carbonaceous chondrite from Antarc-
tica. Nature 282, 1183–1186.
Shimoyama, A. , Harada, K. and Yanai, K. (1985) Amino acids
from the Yamato-791198 carbonaceous ... study, the abun-
dance of Gly, L,D-Ala, AIB, and L,D-isovaline (Isoval)
is examined, because Gly and Ala are abundant amino
acids in most extraterrestrial materials, and AIB and Isoval
are free ... from Itokawa 69
Fig. 6. Mass spectra of negative ions in ToF-SIMS analysis. a) Hayabusa particles extract, and b) blank extract.
64 H. Naraoka et al.
material analyses (Fig. 1). The -0017 particle...
- 12
- 509
- 0
Tài liệu Gynecological cancer patients’ differentiated use of help from a nurse navigator: a qualitative study ppt
Ngày tải lên :
13/02/2014, 06:20
... the NN – they had another better help before the
NN contacted them.
The NN took the primary contact to the female
patients and offered help in the early part of a cancer
trajectory. The NN was ... what kind of add-
itional help the patients should have. Navigators in
cancer care have been proposed to embrace this extra
help. They help the cancer patient “not only travel
the healthcare maze ... I have heard
nothing. I find that scary. (At discharge)
Doctors . come and go as they see fit . they come
and say their bit and then they leave again (ye s)
they can go as far as to turn their...
- 11
- 695
- 0
Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc
Ngày tải lên :
21/02/2014, 15:20
... oxidase from Paracoccus
denitrificans. Nature 376, 660–669.
8. Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T.,
Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R. &
Yoshikawa, ... sealed with another CaF
2
plate, and placed into
a metallic sample holder. The following cuvette handling
was carried out in the aerobic atmosphere. The absorbance
spectra of the mixture before and ... sample containment, maintained at 4 °C, was purged
with dry air to minimize absorbance by water vapor. A
water-cooled globar was used as source of radiation, which
was measured by a nitrogen-cooled...
- 8
- 474
- 0
Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt
Ngày tải lên :
07/03/2014, 00:20
... 489–495.
4 Kinoshita S, Terada T, Taniguchi T, Takene Y, Masu-
da S, Matsunaga N & Okada H (1981) Purification and
characterization of 6-aminohexanoic acid oligomer
hydrolase of Flavobacterium sp. ... S
& Higuchi Y (2005) Crystallization and x-ray diffrac-
tion analysis of 6-aminohexanoate-dimer hydrolase
from Arthrobacter sp. KI72. Acta Crystallogr
F61,
928–930.
15 Hatanaka HS, Fujiyama ... potentially possesses an advantage for biotechnological applications.
X-ray crystallographic analyses of the G181D ⁄ H266N ⁄ D370Y enzyme and
the inactive S11 2A- mutant–Ald complex revealed that Ald...
- 10
- 625
- 0
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc
Ngày tải lên :
07/03/2014, 02:20
... CAGGCTCGTGGTGCTAAATGCCCGAACTGCCTGTGCTGTG
3f GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG
4f CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAG
GGAT
1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC
2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG
3r ... CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG
3r GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA
Reverse GCTA
GGATCCCTAGCAACCACGGCAC
Table 2. Antifungal activity of WAMP- 1a. IC
50
is the concentration
necessary for 50% growth inhibition.
Fungi ... Escherichia coli and assays of recombinant WAMP-
1a activity against diverse plant pathogens, such as
chitin-containing and chitin-free fungi, and Gram-
positive and Gram-negative bacteria. The amino acid
sequence...
- 10
- 505
- 0
Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx
Ngày tải lên :
07/03/2014, 15:20
... survival) after irradiation. The in vivo
biological activity was assayed by the ability to prevent UV
induced erythema of human skin. After informed consent
and approval from the Ethical Committee ... DNA lesions depends on the capacity of
the cell to repair the damage before it can be incorporated
permanently into the genome. Typically, DNA damage is
repaired at a relative high rate in human ... cyanobacteria,
corals and other marine organisms are much more
advanced than those of mammals because photosynthetic
organisms depend on solar irradiation as their primary
source of energy, and at the same time...
- 5
- 450
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
Ngày tải lên :
07/03/2014, 17:20
... collec-
tion and refinement are summarized in Table 1. The
program procheck [34] was used to analyse conforma-
tional variations from the defined norms, with the
quality of the Ramachandran plots [35] ... to the fact that in the
latter the absence of coordination by the Met does not
impose any conformational constraints and the locali-
zed region of the loop affected by release of the Met
ligand ... To accommodate
K100 as a ligand a number of main-chain atoms are
displaced relative to their positions in the wt structure.
Although backbone deviations are detected at the start
of the ligand...
- 15
- 509
- 0
Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx
Ngày tải lên :
23/03/2014, 12:20
... and
analysed by SDS/PAGE.
Carboxypeptidase assays and expression
of HaCA42 mRNA
Carboxypeptidase assays using the synthetic substrates
furylacryloyl-Phe-Phe (FAPP), furylacryloyl-Ala-Lys
(FAAK) ... enzyme was
analysed by SDS/PAGE (data not shown). By analogy with
the activation of mammalian carboxypeptidases, these
polypeptides correspond to the active HaCa42 carboxy-
peptidase (36 kDa polypeptide) ... in the databases. The two proteins migrating
at 50 and 55 kDa (bands A and B; Fig. 1A) were
identified from their N-terminal sequences as similar to
a- amylase (accession no. AAA17751) from...
- 12
- 458
- 0
Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc
Ngày tải lên :
23/03/2014, 12:20
... of all the b Na-ScTxs from all
the a Na-ScTxs. The a Na-ScTxs have identities of the order
of 50% among themselves, the same being true for all the
b Na-ScTxs (data not shown). However, when the ... constraints were
added to the calculations. The dynamic annealing struc-
ture calculations were performed with the CNS software
suite [44].
Analysis of Na
+
-channel sequences
By searching data banks ... 7.30.
Patch-clamp recordings and data analysis. The currents
were recorded by means of the patch-clamp amplifier
MultiClamp 70 0A (Axon Instruments, Foster City, CA,
USA) at room temperature as previously...
- 13
- 434
- 0
Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot
Ngày tải lên :
23/03/2014, 17:21
... GWMSKIASGIGTFLSGMQQa
DRS B1 AMWKDVLKKIGTVALHAGKAALGAVADTISQa
DRS B2 GLWSKIKEVGKEAAKAAAKAAGKAALGAVSEAVa
DRS B3 ALWKNMLKGIGKLAGQAALGAVKTLVGAE
DRS B4 ALWKDILKNVGKAAGKAVLNTVTDMVNQa
DRS B6 ALWKDILKNAGKAALNEINQLVNQa
PBN2 ... 5Â-AGCATAACTGGAACGTGGG-3Â for
caerin 1.12, 5Â-CAGCAATAAGTGGAACAACG-3Â for
caerin 1.13, 5Â-GTGTTTAGCAACGGATTTACC-3Â
for caerin 1.14 and 5Â-AGCAACGGATCCTAGGA
CAC-3Â for caerin 1.15. The temperature ... isolated
India between 150 and 65 Ma and colonized the Laurasian land mass
after India collided with Asia. Abbreviations; AF, Africa; IND, India;
AUS, Australia; SA, South America; ANT, Antartica....
- 14
- 305
- 0
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx
Ngày tải lên :
23/03/2014, 21:20
... LUVs.
Similar aggregates appeared only very faintly in the absence
of lipids (Fig. 4A) . The rather long lag phase preceding fast
hemolysis (Fig. 1A) may also indicate that the formation of
a functional ... initiation by the mushroom Agrocybe aegerita [3,4].
Moreover, 13 of the ESTs, if translated, are identical with a
138-amino-acid protein (PriA) translated from P. ostreatus
cDNA (EMBL/GenBank/DDBJ databases: ... activity at nanomolar
concentrations. Searches in the nucleotide and protein
databases revealed that the sequence of the ostreolysin
N-terminal 50 amino acids was 88% identical with the
putative PriA...
- 12
- 492
- 0
Báo cáo khoa học: Identification of critical residues of subunit H in its interaction with subunit E of the A-ATP synthase from Methanocaldococcus jannaschii potx
Ngày tải lên :
30/03/2014, 04:20
... and E101–206), the primers 5Â-GTTG
CCA
TGGCTGTGAAATTGATGGGA-3Â (forward), 5Â-CTCCG
AGCTCTCATGGCAGTTTAAC-3Â (reverse) and 5Â-ATA
CCATGGAACAGCCAGAGTATAAAG-3Â (forward), 5 Â-
AGG
GAGCTCTCAGAATAACTTCTCTGTA-3Â ... pos-
sesses a water-soluble A
1
domain, containing the cata-
lytic sites, and an integral membrane A
0
domain,
involved in ion translocation [2–4]. The primary struc-
ture of the archaeal ATP synthase ... association was obtained
by titration studies using the N-terminal peptides E1–20, E21–40 and
E41–60. These data indicate that the N-terminal tail E41–60 interacts with
the N-terminal amino acids...
- 10
- 351
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2