... aim of validating the questionnaire (Lendal et al 1998) Data analysis Initially bivariate analyses were performed, and variables having p-values below 0.15 were included in the multivariate analysis ... M Larsen et al be an indication that AR has developed Some parasites survive treatment, what facilitates selection of AR parasites (Prichard 1994) This makes it necessary to investigate the association ... factors associated with high endoparasite burden and 2) to evaluate the efficiency ofa single anthelmintic treatment ofDanish horses Materials and methods In 1994 veterinarians from "The Danish...
... Textbook of Paediatric Advanced Life Support, Dallas 1988:43-44 American Heart Association: Guidelines for Cardiopulmonary Resuscitation and Emergency Cardiovascular Care, Part 12: Paediatric Advanced ... al Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2010, 18:37 http://www.sjtrem.com/content/18/1/37 10 11 12 13 American Heart Association and American Academy of Paediatrics: ... for approval Data are presented descriptively Numerical variables were summarised using median and range Categorical data were presented as frequencies (percentage) Results We received a total of...
... E, Nakamura Y, Sato S, Tabata S: A large scale analysis of cDNA in Arabidopsis thaliana: generation of 12,028 nonredundant expressed sequence tags from normalized and size-selected cDNA libraries ... GCCCTGTGTTTCAAATCCTGAGGAGCCACAAGGACAGCTA 100 60 Ss1.1-rnlu1830b_g11.5 SP-C TGTACATCTAGGAAACATCAGATTCTTTGGTGGTAGAAGCC 201 60 Ss1.1-rill310b_f20.5 Gastrotropin TGAACAGCCCCAACTACCACTCATGCCAGCTTCTTGCTTA 110 60 Ss1.1-rduo424b_g21.5 ... TCCTGGTCCTTTTTGACACCTAGAGGACTTGCTGGGGTTG 108 60 Ss1.1-rhyp08c_e13.5.5 Myelin basic protein GCAGGGCATAGAGATGGTGTCCCGACCCTGTTAGGAAGAT 100 60 Ss1.1-Liv1-LVRM1E040203.5.5 Fetuin B GCCCTGTGTTTCAAATCCTGAGGAGCCACAAGGACAGCTA...
... separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database system can ... simulates the actions ofa cleaner until a threshold number of clean segments is available again In each run the simulator was allowed to run until the write cost stabilized and all coldstart variance ... the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is reserved...
... nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious data manager may change the value of its data on each cache refresh ... access to cached data than the data manager has permitted (e.g., a write fault on a page made read-only by a pager_data_lock call), the kernel issues a pager_data_unlock call The data manager is ... memory as a cache of secondary storage data pages The effect of this kind of caching on the performance of UNIX and its traditional suite of application programs is dramatic Compilation ofa small...
... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... the signal • Attenuation – A loss of signal strength • Multipath distortion – As a radio signal is transmitted, the electromagnetic waves spread out 24 Signal Strength (continued) 25 Radio Frequency ... (continued) Antennas • Transmit or receive an RF signal Multiple Access • Only a limited number of frequencies are available for radio transmission – Conserving the use of frequencies is important • Conserving...
... contained a core of Afro-Mediterranean race and spoke an Afroasiatic language Egyptian civilisation displayed many cultural and political patterns later to appear elsewhere in the continent, although ... family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, the Niger-Congo languages, which are spoken ... rainfall declined thereafter, Nilo-Saharan speakers may have carried this culture and later the exploitation of grain southward towards Lake Victoria, although there is as yet no archaeological...
... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology and Intensive Care, Stavanger ... Science Data Service approved the collection and recording of the study data Statistics Data were recorded into a database designed with File Maker (FileMaker Inc., Santa Clara, CA, USA) We used Table...
... of data that could allow for a structured evaluation of the organizational changes It is evident that a well-planned evaluation of changes in the organizations, before they are actually made, ... on performance Acta Anaesthesiol Scand 2010, 54(6):689-695 Handbooks of the Ministry of Social Affairs and Health Ambulance and emergency care services: A handbook for drawing up an alarm procedure ... several databases Approximately 40% of all emergency calls during the period 2002-2005 were available from the municipality-based databases The rest of the data could not be gathered since it was...
... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International Medication System ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...
... Clinically significant oroantral communications a study of incidence and site Int J Oral Maxillofac Surg 1994;23:19-21 Haas R, Watzak G, Baron M, Tepper G, Mailath G, Watzek G A preliminary study of ... and clavulanic acid g The fixed partial prosthesis was removed and the contiguous mucosa appeared healthy A buccal full thickness flap was harvested and the presence ofa small OAF was verified ... characteristics of OAC/OAF; the apexes of tooth 26 were in extremely close approximation to the maxillary sinus, and an area of periapical rarefaction was evident (Fig 1) After the failure of the endodontic...
... use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain tumors By the fact that the rare earth metals trapped inside of the carbon cage are ... evaluation of Gd@C60[C(COOH)2]10 as a MRI contrast agent J Am Chem Soc 2003; 125: 5471-8 Okumura M, Mikawa M, Yokawa T, et al Evaluation of water-soluble metallofullerenes as MRI contrast agents ... relaxation times are unsatisfactory so far, because radiation induced necrosis [58], vital tumor tissue and cerebral metastases are nearly undistinguishable.[51] Additionally, preclinical data suggest...
... companies such as Toshiba(Japanese), Mitsubishi(Japanese), Trane(American) and Sanyo(Japanese) Medical and technical equipment and machinery, mainly imported from the USA, Italy, Germany and Japan ... the basic characteristic about product, which was described by color, trademark, and the package of product Each of the products ofa multinational join stock company has a separate trademark and ... 5D The Marketing Strategy ofa multinational join stock company multinational join stock company has a certain advantage: a multinational join stock company has always kept its prices as competitive...
... clinico-pathologic reference database of 40,000 patients accumulated over more than two decades The MCG reference database used in the computer-database comparative analysis of each patient’s data, was ... Scanlon PJ, Faxon DP, Audet AM, et al ACC/AHA guidelines for coronary angiography: executive summary and recommendations A report of the American College of Cardiology/American Heart Association ... boundary of 95% CI; NaN = not a number; Revasc = coronary revascularization in medical history n Combined Analysis Total USA Asia Germany female male < 65 years 65+ years Female, < 65 years Female,...
... to death is a flushed goldfish and a very rare rump steak at an even rarer barbeque I don’t have many friends In fact I have none at all apart from Tania but I don’t need any All my friends are ... way ofa goose quill dipped in ink and scratched across parchment with a scattering of sand to blot it, nor even that ofa goldnibbed fountain pen and blotter Maybe now and again in biro on a ... a work of fiction Names, characters, places and incidents either are the product of the author’s imagination or are used fictitiously, and any resemblance to any actual persons, living or dead,...
... Personality characteristics Second language acquisition is defined as the learning and adopting ofa language that is not your native language Once you have acquired a foreign language, you have mastered ... simplicity, ease or difficulty of learning, degree of important, elegance, social status, etc Attitudes towards a language may also show what people feel about the speakers of that language Language attitudes ... Community attitudes towards the language being learnt can have a profound impact on SLA where the community has a broadly negative view of the target language and its speakers, or a negative view of...
... hình a nh sau thực hiện file Keygen.Asm Trang 5/10 Benina’s TutASM # 2: Changing Colours ofa Dialog – Ver 1.0 Author: Benina Trang 6/10 Benina’s TutASM # 2: Changing Colours ofa Dialog – ... function fails, the return value is NULL Remarks A solid brush is a bitmap that Windows uses to paint the interiors of filled shapes After an application creates a brush by calling CreateSolidBrush, ... biến, bạn sẽ dễ dàng điều khiển hơn, và chúng ta có thể xo a nó dialog bị hủy và chúng ta a biết chúng ta ko dùng nó nư a Hàm cài đặt brush là hàm sau và lưu nó vào...
... this reason ray tracing can be used as a method for the simulation and approximation of radio wave propagation at high frequencies The ray tracing of radio waves operates in the same manner as optical ... the appropriate electric field value The ray list contains all of the data about rays propagating from a base station to a field point Each field point has a ray list associated with it A ray ... Fitzpatrick As can be seen, it is passed a particular base station, an image and its order, and also the field point As seen earlier a ray is made up of nodes, two of these nodes are always the base...