... subject to Nakagami-m fading In the approach, the Nakagami-m fading channel is seen as an additive noise channel whose noise is modeled as the ratio between a Gaussian random variable and a Nakagamim ... which the authors have shown that the Rayleigh fading channel can be seen as an additive noise channel whose noise is modeled as the ratio between a Gaussian random variable (r.v.) and a Rayleigh ... (analytical) m = 0.6 (analytical) m = 0.8 (analytical) m = 0.95 (analytical) 20 25 30 10−4 10 15 SNR (dB) M = 16 (analytical) M = 64 (analytical) M = 256 (analytical) M = 1024 (analytical) Shayesteh...
... the remaining stain (if any) dried Such photos were then analyzed to measure the surface stain area using an image analysis system (IAS) We chose the above timing because we found by trial and error ... of each suture line were analyzed to measure the width of the scar using the IAS described earlier STATISTICAL ANALYSIS The unpaired two-tailed student t test was used to compare the means among ... and polyamide Scar formation As far as suture-type associated scar formation, the results showed that the least amount of scar was present when the polyurethane suture was used, as compared to...
... such as the quantity and quality of wastewater treated in the STP and the regeneration of the Wonderland Park Assuming that the relationship between utility and attributes is linear in the parameters ... wastewater is treated with secondary treatment and the quality of the water discharged tothe river is high They are willing to pay about half as much to increase the treatment capacity of the ... significant Treated wastewater quantity and quality are significant factors in the choice of a wastewater treatment programme, and ceteris paribus, these two attributes increase the probability that...
... a measurement campaign has to be executed before the actual range measurements can even start The classical methodto calculate the range for a network is to formulate a path loss model based ... for example, equal to 95%, hereby taking into account the predicted average path loss at a certain distance from the transmitter and the standard deviation of the path loss values around the predicted ... 2.4) 2.3 Parameters Used to Analyze Performance This paragraph defines the parameters used to analyze the range of the DVB-H system First, MpegLock and MpegDataLock are explained Next, parameters...
... analysing the data and writing the paper AL participated in the genetic and statistical analysis HSA participated in designing the study, analysing the data and writing the paper GB participated ... participated in the statistical analysis and wrote the paper KNF conceived the study, carried out the literature search and analysis and participated in writing the paper ZR participated in analysing ... Gonda X, Fountoulakis KN, Rihmer Z, Lazary J, Laszik A, Akiskal KK, Akiskal HS, Bagdy G: Towards a genetically validated new affective temperament scale: a delineation of the temperament ‘phenotype’...
... -7.4) The unmeasured anionrelated base deficit was greater than the total base deficit; this was predominantly due tothe alkalinising effect of hypoalbuminaemia (mean albumin effect on base deficit ... two parameters into a single measurement that contains both quantitative and qualitative information This study did not attempt to address the role of lactate, but merely sought to validate amethod ... data collection, preliminary data analysis and co-wrote the first draft of the manuscript SMT conceived the study, performed data analysis and co-wrote the first draft of the manuscript AD participated...
... to detect the ampicillin resistant gene are AmpF (5'-gataacactgcggccaactt-3') and AmpR (5'-ttgccgggaagctagagtaa-3') The reactions were cycled either in a Perkin Elmer thermocycler (DNA Thermal ... (Sigma) was used as an enhancer The reaction was made up to 50 µl with water The primers used to detect HIV-1 LTR are NI2F (5'-cacacacaaggctgacttccct-3') and NI2R (5'gccactccccagtccgccc-3') The ... these factors would similarly affect both the calibration cultures and the sample, allowing a valid, direct comparison of the growth curves To obtain a more precise estimate, an idealised mathematical...
... finding are: • Accurate compute of the soil voltage contour • Accurate computation of the touch voltage • As shown in the next section, the soil voltage contour aid in accurate computation of the fault ... using the measured field data with the aid of engineering software Figure 11 shows the computed results as per equations (2), (8) and thefield tests results The figure shows the advance accuracy ... condition The touch voltage is the difference between the pole EPR and the soil voltage at the feet of the person standing or 1.5meters away from the pole According to [8], the relative value of the...
... Niranjayan, A Nallanathan and B Kannan, “Exact Modeling of Multiple Access Interference and BER Derivation for TH-PPM UWB”, WCNC 2005, Accepted for publication [5] S Niranjayan, A Nallanathan and ... Furthermore, the channel gain is modeled as a log-normal random variable Therefore, in order to make the analysis theoretically tractable, certain simplifying assumptions are made The channel gain h ... technologies to choose the right candidate for the purpose of implementation or standardization It is important to have theoretical tools to evaluate these performance measures accurately, especially the...
... parent state P ∗ moving it tothe same level as state N ∗ , where the states of P ∗ and N ∗ now share the same parent, state S (9) where x and y are words adjacent to each other in the training ... when a final state is entered The difference between a standard HMM and a hierarchical HMM is that individual states in the hierarchical model can traverse toa sequence of production states, ... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally,...
... primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) For PCR, the reaction mix consisted of · Taq buffer containing 1.5 mm ... procedures Animals Shrimp were purchased from a local seafood market They were acclimated in the laboratory at 25–28 °C in an indoor aquarium for days before rMeMIH-B or dsRNA injection The GSI was calculated ... northern blot analysis of MeMIH-B expression in the eyestalk (Es) and thoracic ganglia during the gonad maturation cycle Each lane represents an RNA sample from the eyestalk or the thoracic ganglion...
... run across the slope The drainage canal should empty out into a gully carrying the excess water away from the farm The depth and width of the drainage canal may vary according to slope and average ... A (ATIK, 1992) Make a drainage canal at the top of the farm that gradually winds down the slope at a one degree angle This canal will cross and link with the out flow ends of the contour canals, ... the field; or they can be sown in a pot and then planted in thefield All three ways have advantages and disadvantages Bare-rooted seedlings (those from seedbeds) are easier to transport to the...
... of the manipulator torch tip on the x-y plane tothe center C of platform, φ w is the heading angle in the horizontal plane of the welding torch, and φ C is the heading angle of the mobile platform ... on, and the manipulator has the duty of reaching tothe altitude of the welding point 2.2 Kinematic Modeling for the Mobile Platform The kinematic equation of the platform can be described as the ... with respect tothe tangent line of the welding trajectory at the welding point The rotation of the last link assures that the orientation of torch has a right gesture at the certain Trang TẠP CHÍ...
... Theoretical and practical considerations In analyzing microvascular images there are trade-offs to be made, and several theoretical and practical considerations may influence these choices The subtler ... during the stabilization process (Figure 3) As a result, the final image is smaller than the original one, but the software displays this transformed image at the same size as the original image, altering ... immediately captured on a computer using a dedicated videocard, and the images should be stored at full size as DVAVI files to allow computerized frame-by-frame image analysis and use for educational...
... and even produce the right meanings 1.3.2 Approaches tothe teaching of speaking The grammar- translation method In the Grammar- translation method, students are taught to analyze grammar and ... context, the research approach and information of participants and main instruments applied in the study Chapter presents the documentation and data analysis The analysis and discussion on the data are ... giving each of the performers a chance to participate and monitoring their performance to see that it is satisfactory At the final stage, the production one, the teacher takes on the role of manager...
... boundary bΩ and zo be a boundary point Assume that Ω has the f -Property at zo with f satisfying ∞ da < ∞ for some t > 1, and denote by (g(t))−1 the above, finite, integral Then, af (a) t there ... Lee Asymptotic behavior of the Kobayashi metric on certain infinite-type pseudoconvex domains in C2 J Math Anal Appl., 256(1):190–215, 2001 [Lee08] Lina Lee Asymptotic behavior of the Kobayashi ... in Cn , then the size of the Kobayashi metric has been described by I Graham [Gra75], D Catlin [Cat89], G Herbort [Her92] and L Lee [Lee08] In these classes of domains, there exists a quantity...
... AGGTATGTTATTGCGTTATTTTG-3¢ 5¢-CAAAATAACGCAATAACATACCTCAT TTTGTAAAGAGAGTTGTTGAAG-3¢ 5¢-CCCTTCAACAACTCTCTTTACAAATTTTATGTTATTGCGTTATTTTGTC-3¢ 5¢-GACAAAATAACGCAATAACATAAAATTTGTAAAGAGAGTTGTTGAAGGG-3¢ This This ... K762Ns K762Nas F763Ms F763Mas R764Ds R764Das 5¢-CCCTTCAACAACTCTCTTTACAAC TTTAGGTATGTTATTGCG-3¢ 5¢-CGCAATAACATACCTAAAGTT GTAAAGAGAGTTGTTGAAGGG-3¢ 5¢-CTTCAACAACTCTCTTTACAAAATG AGGTATGTTATTGCGTTATTTTG-3¢ ... Gregori et al membrane In the cytoplasm, weak acids encounter a more neutral pH, causing their dissociation into acid anions and protons The protons lead to cytoplasmic acidification, thereby inhibiting...
... GCTCCATGCCTCAGTTACTGCAAAACATTAATGGG ATCATCGAGGCC-3¢; reverse 5¢-GGGGACCACTTTGT ACAAGAAAGCTGGGTCGGCCAGCGGCTTAAGGTT TTATTGATGCATTAGGGTAGATGGGGC-3¢ Human SEP53 gene was subcloned into the Gateway entry vector pDONR201 ... quantify the bile acids from patients Standard ratios represent the peak area of each mgÆmL)1 standard compared with the peak area of the internal standard (B) Summary of the range of the total ... the primers: (a) full-length SEP53, forward 5¢)3¢ CAGTC AAGCTTATGCCTCAGTTACTGCAAAAC and reverse 5¢)3¢ CATAGCTCGAGTCATGGCTTGGTGCTTCTC; (b) DCa–SEP53, forward 5¢)3¢ TGCTAGAATTCAGATC TATGAGCGAGAGTGCTGAGGGA...