why alu elements are a good substrate for exonization

Báo cáo y học: "Exon creation and establishment in human genes" doc

Báo cáo y học: "Exon creation and establishment in human genes" doc

Ngày tải lên : 14/08/2014, 21:20
... section for formula and Alu in the same orientation (pseudoSS -Alu) and pseudoexons smaller than 80 bp that overlap an Alu in the opposite strand (pseudoSH -Alu) (see Materials and methods for details) ... project and wrote the manuscript AC carried out the analyses All authors read and approved the final manuscript 16 17 18 Additional data files The following additional data are available with ... of this paper Additional data file contains all additional figures (Figures A1 -6), additional tables (Tables A1 -4) and corresponding captions Additional data file contains two tab separated files...
  • 17
  • 188
  • 0
ARBITRATION – A GOOD CHOICE FOR DISPUTES WITH ECONOMIC AND COMMERCIAL NATURE

ARBITRATION – A GOOD CHOICE FOR DISPUTES WITH ECONOMIC AND COMMERCIAL NATURE

Ngày tải lên : 23/06/2014, 09:15
... neutral and adjustable to be more appropriate for each kind of dispute Those advantages can hardly found in litigation at court ENFORCEMENT OF ARBITRAL AWARD Another significant advantage of arbitration ... enforcement of an international arbitral award is far easier and more certain than that of a foreign court judgment41 In brief, arbitration guarantees its parties to reach a final and binding award, ... Kennen, Advantages and Disadvantages of ADR - Understanding Alternative Dispute Resolution (2008), available at http://www.suite101.com/content/advantages-and- disadvantages-of-adr -a5 8925 Garry...
  • 15
  • 1.5K
  • 1
Báo cáo y học: " Is interleukin-1 a good target for therapeutic intervention in intervertebral disc degeneration: lessons from the osteoarthritic experience" pdf

Báo cáo y học: " Is interleukin-1 a good target for therapeutic intervention in intervertebral disc degeneration: lessons from the osteoarthritic experience" pdf

Ngày tải lên : 09/08/2014, 10:21
... intra-articular delivery of anakinra (recombinant methionyl human receptor antagonist (r-met HuIL-1ra)) may have beneficial effects on symptoms and structural modifications in animal models of OA ... pain and disease activity A first randomized controlled trial in patients with knee OA demonstrated a good safety profile for one intra-articular injection of IL-1ra (150 mg, the maximum tolerated ... We performed a multicenter, randomized, double-blind, placebo-controlled study to evaluate the clinical response, safety, and tolerability of a single intra-articular injection of anakinra (50...
  • 2
  • 412
  • 0
Why Copying LIS from a Developed Country Does Not Work for a Developing Country?

Why Copying LIS from a Developed Country Does Not Work for a Developing Country?

Ngày tải lên : 18/10/2013, 14:15
... and social implications The LIS suitable for developing countries must be capable of providing a sound base for economic and environmental planning This is certainly the theory ... ể From Pharaohs to Geoinformatics FIG Working Week 2005 and GSDI-8 Cairo, Egypt April 16-21, 2005 ộ TS – Applied SIM and SDI Trung Tran and Don Grant TS9.6 Why Copying LIS from a Developed ... that it is so in practice Accordingly developing countries may require a more complex approach to an LIS than the relatively simple use of the LIS in many developed countries SUMMARY (Vietnamese)...
  • 2
  • 422
  • 0
Tài liệu THE ELEMENTS OF BACTERIOLOGICAL TECHNIQUE A LABORATORY GUIDE FOR MEDICAL, DENTAL, AND TECHNICAL STUDENTS pptx

Tài liệu THE ELEMENTS OF BACTERIOLOGICAL TECHNIQUE A LABORATORY GUIDE FOR MEDICAL, DENTAL, AND TECHNICAL STUDENTS pptx

Ngày tải lên : 16/02/2014, 22:20
... is ready for sterilisation CLEANING OF GLASS APPARATUS All glassware used in the bacteriological laboratory must be thoroughly cleaned before use, and this rule applies as forcibly to new as to ... tubular apparatus with sharp curves, and for coating newly-made glass apparatus with a layer of soot to prevent too rapid cooling, and its usually associated result—cracking Fig 12.—Glass blower's ... EYRE GUY'S HOSPITAL, S E [Pg ix] CONTENTS PAGE I LABORATORY REGULATIONS II GLASS APPARATUS IN COMMON USE The Selection, Preparation, and Care of Glassware, 8—Cleaning of Glass Apparatus, 18—Plugging...
  • 666
  • 511
  • 0
A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc

A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc

Ngày tải lên : 06/03/2014, 08:20
... interventions A New Tool for Scaling Impact 15 15 outcomes (such as smoking cessation) are achieved Foundations could act as payor via performance-based grants on projects that have large societal value, ... Collaboration with relevant government agencies will also be necessary to gain access to administrative data, such as Medicaid records Administrative data will allow evaluators to assess program ... risks, as well as financial and social returns, are properly articulated and managed They will require tools, such as a credit scorecard, that reflect an intermediary’s methodical and careful...
  • 36
  • 262
  • 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

Ngày tải lên : 07/03/2014, 05:20
... sub5910 strates of H+ ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1) ... [Gly1-14C]Gly-Sar (specific radioactivity 53 mCiÆ mmol)1) was custom synthesized by Amersham International (Little Chalfont, UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic ... measured at different pH values (n ¼ 4) (18 nm) at pH 6.0 was linear for up to h and reached a plateau after h of incubation (Fig 4) The uptake was found to be saturable: unlabeled Bip-Pro at a...
  • 10
  • 490
  • 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Ngày tải lên : 07/03/2014, 05:20
... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast ... membrane was from Millipore (Bedford, MA, USA) Goat polyclonal anti-(yeast Vps4p) IgG was from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and rabbit polyclonal anti-(carboxypeptidase Y) and anti-calmodulin ... the AAA superfamily typically contain one or two ATPase domains that assemble into one or two stacked hexameric rings The ATPase catalytic site is located at the interface between adjacent ATPase...
  • 23
  • 490
  • 0
Báo cáo khoa học: KCTD5, a putative substrate adaptor for cullin3 ubiquitin ligases docx

Báo cáo khoa học: KCTD5, a putative substrate adaptor for cullin3 ubiquitin ligases docx

Ngày tải lên : 07/03/2014, 06:20
... et al KCTD5, a new substrate- specific adaptor for Cul3 Biotechnology Inc (Santa Cruz, CA, USA), anti-cullin was from Abcam (Cambridge, UK), and mAbs against b-actin, PHA, FLAG M2 mAb and PMA were ... supported by a grant from Programa Nacional de Biologı´ a Fundamental (Grant BFU200601203 ⁄ BMC), Red Cardiovascular from Instituto de KCTD5, a new substrate- specific adaptor for Cul3 ´ Salud Carlos ... 31 32 human medulloblastoma Proc Natl Acad Sci USA 101, 10833–10838 Matsuda N, Azuma K, Saijo M, Iemura S, Hioki Y, Natsume T, Chiba T, Tanaka K & Tanaka K (2005) DDB2, the Xeroderma pigmentosum...
  • 11
  • 402
  • 0
Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt

Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt

Ngày tải lên : 07/03/2014, 21:20
... because the canonical amino acids which define substrate specificity are replaced in a nonconservative manner, glutamine-asparagine instead of lysine-aspartate All mammalian membrane-bound ACs ... In all structures of canonical ACs, i.e mammalian AC, trypanosomal AC and mycobacterial AC Rv1264 the lysine-aspartate couple forms a salt bridge [5,7,26] Even in Rv1900c the asparagine-aspartate ... of the available structural data of canonical mammalian class IIIa and mycobacterial class IIIc catalytic domains [5,7,9,25] nor they parallel the findings on the noncanonical class IIIc AC Rv1900c...
  • 8
  • 401
  • 0
Báo cáo khoa học: "Phrase Table Training For Precision and Recall: What Makes a Good Phrase and a Good Phrase Pair?" doc

Báo cáo khoa học: "Phrase Table Training For Precision and Recall: What Makes a Good Phrase and a Good Phrase Pair?" doc

Ngày tải lên : 08/03/2014, 01:20
... phrase translation accuracy and at the same time extract as many as possible valid phrase pairs that are missed due to incorrect word alignments One approach is to leverage underlying word alignment ... 0.06 Table 1: Phrase pair posterior distribution for the example well, for instance, n-grams that are part of a paraphrase translation or metaphorical expression To give an example, the unigram ... is small 3.2 Bilingual Information Metric Trying to find phrase translations for any possible ngram is not a good idea for two reasons First, due to data sparsity and/or alignment model’s capability,...
  • 8
  • 472
  • 0
Controlling Interest: Are Ceilings On Interest Rates a Good Idea? pptx

Controlling Interest: Are Ceilings On Interest Rates a Good Idea? pptx

Ngày tải lên : 15/03/2014, 01:20
... know or cannot compare rates being charged by various lenders, each lender has more freedom to charge any rate — fair or unfair A high level of borrower awareness can create a natural protection ... no value and add costs Consumers need to match the card to their use and choose accordingly As was stated earlier, a high level of borrower awareness can create a natural protection from unreasonable ... have qualified for cards This increased risks to the banks and necessitated a higher interest rate on unpaid balances The inflation of the late 1970s and early 1980s also had an effect Generally,...
  • 8
  • 505
  • 0
You Are a Brand!: In Person and Online, How Smart People Brand Themselves For Business Success

You Are a Brand!: In Person and Online, How Smart People Brand Themselves For Business Success

Ngày tải lên : 15/03/2014, 23:28
... you are your most important asset—an asset, like education, that no one can take away from you Personal branding shows you how to increase the value of that asset, both in terms of selfactualization—becoming ... people can’t talk about who they are professionally and how they bring real, tangible value to a business situation in a short, conversational dialogue So, I’ve added a new chapter, chapter 9, that ... commercials featuring Broadway musicals and celebrities received numerous creative awards and became a flagship creative account for the agency Part of my job was to work with the Broadway Theater...
  • 733
  • 532
  • 0
Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx

Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx

Ngày tải lên : 16/03/2014, 13:20
... Identification and characterization of two putative human arginine methyltransferases (HRMT1L1 and HRMT1L2) Genomics 48, 330–340 Yanagida M, Hayano T, Yamauchi Y, Shinkawa T, Natsume T, Isobe T & Takahashi ... Recombinant plasmids were transfected in Saccharomyces cerevisiae strain L40 A human fetal brain cDNA library (Clontech, Palo Alto, CA) expressing GAL4 activation domain (AD) fusion proteins was cotransfected ... Functional association of Ki-1 ⁄ 57 and PRMT1 D O Passos et al Preparation of cytoplasmic and nuclear extracts, methylation assays with cellular Ki-1 ⁄ 57 and metabolic labeling Carlos H I Ramos and...
  • 16
  • 367
  • 0
Báo cáo khoa học: Kinetic mechanism for p38 MAP kinase a A partial rapid-equilibrium random-order ternary-complex mechanism for the phosphorylation of a protein substrate potx

Báo cáo khoa học: Kinetic mechanism for p38 MAP kinase a A partial rapid-equilibrium random-order ternary-complex mechanism for the phosphorylation of a protein substrate potx

Ngày tải lên : 16/03/2014, 22:20
... EÆMgATP complex is not a deadend complex with respect to the binding and phos4633 Kinetic mechanism for p38 MAP kinase a A E Szafranska and K N Dalby Fig Preparation of activated p38 MAPKa and ATF2D115 ... overexpressed, activated and purified In our case a sensitive tryptic analysis indicates that the enzyme was fully activated [27] v Vmax ¼ AB aKA KB þ aKB A þ aKA B þ AB ð1Þ The rapid equilibrium assumption ... obtained from Sigma NiSO4 and Ni-NTA agarose for His6-p38 MAPKa purification were provided by Qiagen Inc (Santa Clarita, CA, USA) and Sigma, respectively The His6 tag was removed from p38 MAPKa...
  • 15
  • 554
  • 0
Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

Ngày tải lên : 24/03/2014, 04:21
... Ser274 in ik3-1 cDNA with Thr or Ala, mutagenic primers, 50 -TCTCCGGAGATGTCGAACACT CTCAGGTACTCCCAGACCA-30 or 50 -TCTCCGGAGAT GTCGAACACTCTCAGGTGCTCCCAGACCA-30 (corresponding to amino-acid residues ... Education, Culture, Sports, Science, and Technology of Japan, the Organization for Pharmaceutical Safety and Research and KEIO University Special Grant-in-Aid for Innovative Collaborative Research ... Spots A and B of peptide mapping for lane 4, and spots A0 and B0 of peptide mapping for lane 5, were subject to two-dimensional phosphoamino-acid analysis, as shown in the bottom panels Radioactive...
  • 7
  • 308
  • 0
The Business Case for Fuel Cells: Why Top Companies are Purchasing Fuel Cells Today doc

The Business Case for Fuel Cells: Why Top Companies are Purchasing Fuel Cells Today doc

Ngày tải lên : 29/03/2014, 19:20
... such as National Parks, zoos, aquariums and museums, as well as federal, state and local government agencies and facilities In Asia and Europe, thousands of fuel cells have been installed at homes ... half hour or longer it takes to change out a battery This also eliminates the need for battery storage and changing rooms, leaving more warehouse space for products Another key advantage that ... commercialization date NASDAQ sign in Times Square New York Aquarium Bronx Zoo Los Angeles Yale University Google Headquarters Yellowstone National Park Phipps Conservatory and Botanical Garden...
  • 99
  • 317
  • 0
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

Ngày tải lên : 29/03/2014, 21:20
... methods and analyzed with a microscope, BZ-8100 (Keyence, Osaka, Japan) Acknowledgements We greatly appreciate Dr Masatoshi Maki and Dr Hideki Shibata in our laboratory for providing valuable suggestions ... ª 2010 The Authors Journal compilation ª 2010 FEBS 3571 Preferred substrate peptide for TGase A Yamane et al product was analyzed using imaging software (multigauge software) Evaluation of synthetic ... principle, because cadaverine is an amine substrate known to react with any active TGase Although aberrant TGase activity has been reported in several skin diseases, as a consequence of genetic mutation...
  • 11
  • 645
  • 0
Stakeholder Engagement: A Good Practice Handbook for Companies Doing Business in Emerging Markets pptx

Stakeholder Engagement: A Good Practice Handbook for Companies Doing Business in Emerging Markets pptx

Ngày tải lên : 30/03/2014, 01:20
... responsibilities All staff should be made aware of the program, and understand why it’s being undertaken and what implications it might have for project outcomes Companies that take a systematic (rather than ... organization and power dynamics ■ levels of literacy and health care ■ ability to access technical information ■ cultural values and perceptions 19 20 STAKEHOLDER ENGAGEMENT: PART ONE For additional ... of information can lead to the spread of misinformation about a project that can be both damaging to a company’s reputation, and undermine efforts to engage in an informed dialogue with stakeholders...
  • 201
  • 533
  • 0