which was a reason for european imperialism in the late 19th century
Báo cáo hóa học: "A framework for ABFT techniques in the design of fault-tolerant computing systems" pot
... guarantees that faults representing errors in the processed data will result in notable non-zero values in syndrome sequence Systematic encoding means that the information bits always appear in the ... linear sequential circuit with input memory order m; that is, inputs remain in the encoder for an additional m time units after entering Typically, n and k are small integers, k < n, the information ... using the ABFT A systematic form of convolution codes is especially profitable in the ABFT detection plan because no redundant transformations are needed to achieve the processed data after the...
- 12
- 574
- 0
Báo cáo khoa học: "Is there a place for N-acetylcysteine in the treatment of septic shock" pptx
... microcirculation and thus oxygen extraction, while at the same time attenuating inflammatory responses Prostacyclin, a prostaglandin synthesized in endothelial cells, is a potent vasodilator and an inhibitor ... groups The number of days of acute lung injury was decreased, however, and there was also a significant increase in the cardiac index in the NAC-treated group [20] Conclusions This is an exciting ... demonstrated that the administration of NAC decreased nuclear factor-κB activation associated with decreases in IL-8 in septic patients [19] In a previous multicenter clinical trial in patients...
- 3
- 469
- 0
Báo cáo y học: "Genomic neighborhoods for Arabidopsis retrotransposons: a role for targeted integration in the distribution of the Metaviridae" docx
... RetroMap-generated datafile was used as the data source for statistical testing The data file contains chromosomal element coordinates, LTR identity, age and lineage information for all A thaliana ... element abundance in A thaliana Wright et al [33] examined recombination rate relative to element abundance in detail and found that the abundance of most A thaliana TE families actually had a small ... that of the Pseudoviridae than to the mean lengths of the Athila and Tat lineages The Pseudoviridae are also more uniformly sized than the Metaviridae A second factor contributing to the abundance...
- 16
- 304
- 0
Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt
... TTCCACGCGAAGTTATGCACTTTCAT-3¢, 5¢-AATTTC TTCAGTGGCTTTCGCCACATTGAAAAAATCGGT-3¢, 5¢-GATCCTTTCAGCGAGATCCGCAAACATGTCCGC AAACTC-3¢ and 5¢-TTGCAGCATCCAAATGGACGCTT GCAACTTGGCCAATTG-3¢ for H2 5A, H3 7A, D5 2A and K13 4A, respectively ... Ni–nitrilotriacetic acid beads and eluted by using the incubation buffer including 300 mm imidazole Owing to the appearance of other contaminating protein bands, the eluate was again dialyzed against ... vectors pET-1 1a and pET29c The hpnap gene was amplified by PCR from the H pylori J99 genome using primers HPNAP_up (5¢-GCGGAA TTCCATATGAAAACATTTGAAATT-3¢) and HPNAP_ low (5¢-GCGGGATCCTTAAGCCAAATGGGCTTG-3¢),...
- 16
- 351
- 0
A Build for Every Check-In
... Appearances The waterfall display records the name of each step in gory detail That detailed information is available from each step’s output The information presented in the waterfall display ... interest They are both text files containing information that is sent to the build master info/admin contains this Buildbot administrator’s name and e-mail address, while info/host contains a description ... Instead, the previous installation was used This may seem a pedantic point, but I’ve encountered many situations in which a clean install would fail for one reason or another, but subsequent installations...
- 36
- 423
- 0
Tài liệu A Women’s Health Intervention for Gynecological Problems in the Deployed Environment ppt
... of “make shift measures” to urinate • Dehydration (not drinking fluids to prevent urination) Vaginal symptoms: Itching, burning, pain, & discharge Menstrual complaints: Pain, heavy bleeding, ... Does providing women with information on feminine • hygiene and menstrual self-care practices lead to a decrease in genitourinary complaints during deployment? Specific Aims To increase knowledge ... level about feminine hygiene in the deployed environment To determine the effectiveness of an intervention to decrease: • Vaginal & urinary tract symptoms • Menstrual complaints Women in Bureau...
- 18
- 734
- 0
Tài liệu Báo cáo khoa học: "A Method for Correcting Errors in Speech Recognition Using the Statistical Features of Character Co-occurrence" pptx
... 1245(-8.5) The values inside brackets are the rate of decrease 4.3 More Applicable for a Result Having a Few Errors In EPC+SSC, the rate of decrease was 8.5%, and the decrease was obtained in all type ... of the actual utterance (A) No lacking in the meaning of the actual utterance, and with perfect expression (B) No lacking in meaning, but with slightly awkward expression (C) Slightly lacking in ... including errors from the StringDatabase (the former string is referred to as the Similar-String, and the latter as the Error-String) Finally, the correction is made using the difference between these...
- 5
- 588
- 0
Tài liệu Báo cáo khoa học: "A PROGRAM FOR ALIGNING SENTENCES IN BILINGUAL CORPORA" docx
... boundaries The dataset was sufficiently small that it was possible to correct the reznaining mistakes by hand For a larger dataset, such as the Canadian Hansards, it was not possible to check the ... rate is considerably lower in the Canadian Hansards because the translations are more literal ratio This probabilistic score is used in a dynamic programming framework in order to find the maximum ... (Table 4) for use in lexicography (Klavans and Tzoukermann, 1990) 178 It is remarkable that such a simple approach can work as well as it does An evaluation was performed based on a trilingual corpus...
- 8
- 494
- 0
Báo cáo " A new Environmental Poverty Index (EPI) for monitoring system in the SEA (Strategic Environmental Assessement) procedure " docx
... generally The latter are those poor people who not live in such marginal areas ADB assumes that in certain rural locations, the primary reason for an inability to escape poverty has to with the natural ... material poverty, and an inability to acquire the material things necessary to live well Environmental poverty in Asia and the Pacific Poverty in Asia and the Pacific is increasingly concentrated in ... natural environment For example, assessments of the poor living in dryland areas may conclude that the main reasons for their persistent poverty are marginal land and a lack of access to water...
- 9
- 352
- 0
Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt
... metachromatically staining granules seen in mature MCs have been poorly investigated In a recent study, we generated a mouse strain in which the SG gene was targeted [10] We found that, in the absence ... a maximal plateau of storage was already seen at day 12 Both proCPA and mature CPA were detected in SG+ ⁄ + cells A dramatically different pattern was seen in SG– ⁄ – cells mMCP-5 protein was ... protein in the conditioned medium from SG– ⁄ – cells was considerably higher than the intracellular level, indicating that secretion rather than storage is the dominating pathway for mMCP-6 in the...
- 12
- 438
- 0
Báo cáo khoa học: Structural evidence for a constant c11 ring stoichiometry in the sodium F-ATP synthase doc
... constant c11 ring stoichiometry 5¢-GGAGGAAATAAGCATATGGATATG-3¢ (forward), containing an NdeI site, and 5¢-CCTTTCAGGAAGCT TCCTCC-3¢ (reverse), containing a HindIII site The PCR product and plasmid ... processing system (Synoptics Ltd, Cambridge, UK) Alternatively, the rotational power spectrum of each individual particle was calculated and then averaged (data not shown) It appeared that all averaged ... with a prestained marker ¨ After the run, the c11 ring was visible, without staining, as a result of the high local protein concentration The band was excised from the gel with a scalpel and subjected...
- 10
- 477
- 0
A Strategy for Cancer Control in Ireland - National Cancer Forum 2006 pdf
... uncertainty, including having too low a caseload to maintain clinical expertise in the use of complex diagnostic and treatment techniques, staff training, quality assurance and risk management strategies ... information and offer an ongoing ability to measure a wide variety of cancer data in a manner that can easily be compared between countries and over time They are therefore an invaluable asset at all ... patients and families This will enable a range of benefits including the incorporation of palliative care into patient care plans at an appropriate stage in the management of their disease; an enhancement...
- 68
- 391
- 0
Báo cáo khoa học: "A System for Detecting Subgroups in Online Discussions" pptx
... Empirical Methods in Natural Language Processing, pages 724–731, Vancouver, British Columbia, Canada, October Association for Computational Linguistics Amitava Das and Sivaji Bandyopadhyay 2011 ... bundled with the system in the same package The system works on all the standard platforms The system has a command-line interface that provides full access to the system functionality It can be used ... has a Java API that can be used by researchers to develop other systems using our code The system can process any discussion thread that is input to it in a specific format The format of the input...
- 6
- 411
- 0
I Never Knew There Was a Word For It
... Siberia) is the gap between spread legs, and awawa (Hawaiian) that between each nger or toe While jahja in Wagiman (Australia) and waal in Afrikaans both mean the area behind the knee Skin deep ... ketsi in Greek, atal atal in Occitan (France), asina asina in Asturian (Spain), elae belae in Azeri (Azerbaijan) and azoy azoy in Yiddish Happy talk Good or bad, modest or conceited, hard-working ... India) to walk arm in arm or hand in hand uitwaaien (Dutch) to walk in windy weather for fun murr-ma (Wagiman, Australia) to walk along in the water searching for something with your feet ’akihi...
- 315
- 450
- 1
Smart Business, Social Business: A Playbook for Social Media in Your Organization
... Qantas Airlines jet airliner had crashed on Batam Island in Indonesia Qantas Airlines: No Crash, Despite Lots of Rumors After an emergency landing, rumors of a Qantas Airlines plane crash circulated ... not about social brands It’s about an organization’s natural (sometimes forced) evolution into a social business A social business deals with the internal transformation of an organization and addresses ... reports from TV and Twitter it’s a Qantas airliner which crash at Batam @smillavtr: Chapter Human Capital, Evolved 17 Reports that a Qantas plane may be involved in a crash in Indonesia http://ow.ly/349sJ...
- 273
- 310
- 0
Báo cáo khoa học: "A Feedback-Augmented Method for Detecting Errors in the Writing of Learners of English" docx
... in training data For simplicity of implementation, they are excluded from training data Note that the tagging rules can be used only for generating training data They cannot be used to distinguish ... chicken/mass for dinner where (4) ¢ £¡ (2) Now rules that match the template can be obtained from the training data All we need to is to collect words in from the training data Here, the words in Table ... taken into account in this paper, the feedback corpus contains further useful information For example, we can obtain training data consisting of instances of errors by comparing the feedback corpus...
- 8
- 502
- 0
Auditing for Social Change: A Strategy for Citizen Engagement in Public Sector Accountability docx
... reducing maternal mortality In South Africa, the Institute for Democracy in South Africa played a substantial role in strengthening the new financial management act by insisting on the inclusion ... merit debate include: • What role can the media play in publicizing results of audits and advocating for citizen’s right to information? • What are the advantages and disadvantages of the audit ... criminal activity in the following countries: the United States, the Philippines, Bhutan, Indonesia, Malaysia, Spain, Romania, Moldova, China, Estonia, Lithuania, the United Kingdom, South Africa,...
- 220
- 373
- 1
Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx
... (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, Mauritius, Nepal, Philippines, Tanzania, Tunisia, U .A. E., ... frequent in Arab populations and to translate that to clinical management, including diagnosis, prevention and therapeutics It aims to establish excellence in the Middle East/North Africa region in the ... population Weill Cornell Medical College in Qatar’s charge includes a leadership role in the effort to address important biomedical research and healthcare needs in Qatar The main focus of Qatar...
- 8
- 375
- 0
Báo cáo hóa học: " A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter" pot
... AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA GGAGCT AGGAAAAAAATCGATCGCGTTAAGATACATTGAGTTTGGA C PCR to check pAd5CMV-EGFP GGCACCAAAATCAACGGGAC AGGAAAAAAATCGATCGCGTTAAGATTACATTGAGTTTGGA C Amplification of TK from pMBP-TK AGGAAAAAAATTTAAATGCGCGTATGGCTTCGTAC ... GATAACAGATTTAAATCCTTCGAACAGAATCGAT GGCCATCGATTCTGTTCGAAGGATTTAAATCTGTT PCR to check pAd5CMV/TCS CGTGTCATATGGATACACGGG TCCAGCATGGCTACAACCTC EGFP amplification from pEGFPC3 AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA ... AGGAAAAAAATTTAAATGCGCGTATGGCTTCGTAC AGGAAAAAAATTTAAATGAGTTAGCCTCCCCCATC AGGAAAAAATTCGAATCAGTTAGCCTCCCCCATC plasmid was then used to replace the E3 region by the CMVp and TCS, in pTG3622, using...
- 4
- 451
- 0
báo cáo hóa học:" Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" doc
... (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, Mauritius, Nepal, Philippines, Tanzania, Tunisia, U .A. E., ... frequent in Arab populations and to translate that to clinical management, including diagnosis, prevention and therapeutics It aims to establish excellence in the Middle East/North Africa region in the ... population Weill Cornell Medical College in Qatar’s charge includes a leadership role in the effort to address important biomedical research and healthcare needs in Qatar The main focus of Qatar...
- 8
- 494
- 0
- us imperialism in the late 19th century was supported by which theory
- describe two reasons for american imperialism in the late 19th century
- two reasons for american imperialism in the late 19th century
- which prompted european imperialism in the late nineteenth century
- which prompted european imperialism in the late nineteenth century points 3
- which did not prompted european imperialism in the late nineteenth century points 2
- 13 which did not prompted european imperialism in the late nineteenth century
- which was a reason for european imperialism in the late nineteenth century
- which was used to justify european imperialism in the late nineteenth century
- european imperialism in the late 19th century
- which was not used to justify european imperialism in the late 19th century
- which was not used to justify european imperialism in the late nineteenth century points 2
- which was not used to justify european imperialism in the late nineteenth century points 3
- which was not used to justify european imperialism in the late nineteenth century points 5
- which was not used to justify european imperialism in the late nineteenth century
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25