when the clearinterval action is assigned to a button top it will remove the setinterval identified as myinterval the movie will no longer advance to the next frame continuously and the slide show will stop

Báo cáo hóa học: " Our vision for this new SpringerOpen Access journal, Psychology of Well-Being: Research, Theory and Practice, is to promote a distinctly eclectic approach to investigating well-being. When the prospect of " pdf

Ngày tải lên : 21/06/2014, 06:20

... journal but we feel the research climate and resources are now supportive of these types of challenges Well-being research has increased substantially over the past decade and the demand to disseminate ... individuals across the lifespan and across the globe This is an inter-disciplinary task The scientific research community is considerably more accepting of well-being studies today than it was several ... work has been instrumental in understanding the factors that are associated with well-being For example, we now have considerable insight into the role of personality and sociodemographic factors...

3
432
0

Báo cáo sinh học: " Response to mass selection when the genotype by environment interaction is modelled as a linear reaction norm" pptx

Ngày tải lên : 14/08/2014, 13:22

... individuals of the same litter The slope of a linear reaction norm is a measure of sensitivity towards environmental change, which can be treated as a trait of the animal [8] Genetic variation for the ... a e a and σ21 are the genetic and environmental variances of slope, and a0 a1 and e σe0 e1 are the genetic and environmental covariances between level and slope, and P = G + E The heritability ... of the shape of the reaction norm Another approach is to model G × E as a linear reaction norm The advantage of this model is that selection response can be predicted not only in the phenotypic...

20
172
0

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Ngày tải lên : 16/02/2014, 09:20

... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT ... 3¢ to the core domain resulted in a similar deadenylation and overall mRNA decay rate [33] The PAI-2 ARE is unusual in that in addition to an auxiliary domain (Fig 7, the atypical AU-rich ARE...

14
635
0

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspeciﬁc alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Ngày tải lên : 19/02/2014, 17:20

... (ordinate, unit per mL fraction) BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (250 kDa) were loaded on to a separate gradient as molecular mass markers alkaline phosphatase (unit/mg ... dehydrogenase (a, 141 kDa) and catalase (c, 250 kDa) were loaded on to a separate gradient as molecular mass markers Not only the aggregate but also the covalently linked dimer almost disappeared ... applied on the top of sucrose-density-gradient analysis (5–35%) After centrifugation, each 400 lL fraction was collected from the top of the gradient and assayed for alkaline phosphatase activity (ordinate,...

14
445
0

Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx

Ngày tải lên : 07/03/2014, 09:20

... Superimposition of monomers A and C of SaSTP, and MtSTP monomer A [9] Monomer C of SaSTP is magenta as in Fig 2A, monomer A is blue and MtSTP is gray Metal ions and nucleophilic water molecules are shown ... from the ﬂap domain [9] There are homologous residues to Asp118 and Asp191 in HsSTP (Asp146 and Asp239) and, of course, in SaSTP (Asp118 and Asp192) Our SaSTP crystal structure provides clear evidence ... [ED]-hydrophil-X(1,2)-[ST]-X-P, allows similar interactions to those described here and is present in the S agalactiae PPase, kinase and adenylosuccinate synthase, but not in S agalactiae CovR ⁄ CsrR The motif is located at...

10
542
0

Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Ngày tải lên : 15/03/2014, 00:20

... light and heavy precursor masses for cross-linked candidate peptides analysis NanoLC-LTQ-Orbitrap data were processed automatically as described as well as manually 10 Acknowledgements 11 We are ... The list of light and heavy precursor masses was further used either to analyze the MS ⁄ MS spectra acquired in the data-dependent acquisition analysis or to build an inclusion list with the light ... identify all the peptides in our list using the available softwares (gpmaw [30], xquest [31] and msx-3d [12]) with a mass tolerance of p.p.m We therefore used MALDITOF-TOF and ⁄ or nanoLC-Orbitrap tandem...

12
510
0

Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx

Ngày tải lên : 23/03/2014, 07:20

... A thaliana; lanes and 7, Raphanus sativus; lanes and 8, Brassica rapa; lanes and 9, B rapa var glabra; lanes and 10, B oleracea var italica The amount of protein applied was lg for A thaliana ... to clarify the mechanism of the speciﬁc tight association of PCaP1 with the plasma membrane in vivo and in vitro Almost all PCaP1 was associated with the membrane and was not released by treatment ... such as phosphoinositide 3-kinase and plasma membrane Ca2+-ATPase The presence of CaM and Ca2+ suppressed the interaction of PCaP1 with PtdInsPs The binding of PCaP1 to the plasma membrane was not...

16
424
0

Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery ﬁbroblasts A role for phosphoinositide 3-kinase pot

Ngày tải lên : 24/03/2014, 03:21

... transduction directly but instead acts as a cofactor for the cleavage and activation of PAR4 [27] Thrombin has been shown to cleave and activate PAR1, PAR3 and PAR4, whereas trypsin cleaves and ... via a classical PAR2 In summary, this study has demonstrated that duodenase induces DNA synthesis in pulmonary artery ﬁbroblasts and that this response may be mediated by an atypical PAR, either ... PAR2, PAR3 and PAR4 [11] Interestingly, thrombin has now been demonstrated to cleave and activate PAR1, PAR3 and PAR4 whereas trypsin and tryptase activate PAR2 [12] Certain other proteases, including...

10
437
0

How to Help With Math Homework - When the Answers Aren’t in the Book (A Guide for Students, Families, & Friends) pot

Ngày tải lên : 31/03/2014, 12:20

... mathematical ideas, connect mathematical concepts, ask questions that help students see things in new ways and provide the mathematical terminology that allows us to understand each other It is ... Beaudry and William Blatner Photos by William Blatner and Jackie Rigali How to Help With Math Homework When The Answers Aren’t in the Book Many math curricula, such as the Interactive Math Program ... numbers and trying to solve the simpler problem Then go back and try that approach with the original problem Ask if the student can make an estimate of the answer If the answer is a number, about...

12
480
0

WHAT IS BETA GLUCAN? A Concise Guide to the Benefits and Uses of the Most Powerful Natural Im- mune Enhancer Known to Science ppt

Ngày tải lên : 31/03/2014, 22:20

... Bratislava in Slovakia in 1986 (Methods and Findings of Experimental and Clinical Pharmacology v 8) it was shown that yeast beta glucan increased the macrophage activity of guinea pigs It was also ... defined Beta glucan was bound to radioactive dye and the course of action was following after oral administration to mice The macrophages took up the glucans, and then transported them to the spleen, ... (International Immunopharmacology v 7, 2007) were given beta glucan Their average age was 52, and their cancer was in the advanced stage It was concluded, “Beta glucan administration seems to stimulate proliferation...

51
527
3

– THE GRE QUANTITATIVE SECTION – The area of a sector is found in a similar way to ﬁnding the pptx

Ngày tải lên : 18/06/2014, 17:20

... value (the median), and/ or the average of all the values (the mean) M EAN AND M EDIAN To find the average, or the mean, of a set of numbers, add all the numbers together and divide by the quantity ... Review Many questions on the GRE will test your ability to analyze data Analyzing data can be in the form of statistical analysis (as in using measures of central location), finding probability, and ... an increase, whereas a line sloping down represents a decrease A flat line indicates no change as time elapses – THE GRE QUANTITATIVE SECTION – Percentage and Probability Part of data analysis...

25
410
0

Báo cáo sinh học: "Bisphosphonate-associated osteonecrosis of the jaw is linked to suppressed TGFb1-signaling and increased Galectin-3 expression: A histological study on biopsies" pot

Ngày tải lên : 18/06/2014, 19:20

... preparation for immunohistochemical staining Immunohistochemical staining was performed with the alkaline phosphatase-anti-alkaline phosphatase method and an automated staining device (Autostainer ... histopathologic diagnostics Each specimen included was confirmed to exhibit histopathologic aspects of BRONJ In addition to the histopathologic characteristics of BRONJ, the inclusion criteria ... interpreted the data and wrote part of the manuscript, particularly the discussion section EN interpreted the data and harvested the samples KA established the immunohistochemistry, analyzed the tissue...

11
416
0

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Ngày tải lên : 18/06/2014, 22:20

... PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed our earlier ... Molecular Systems) was used To monitor the presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; ... weaker due to the fact that two non-canonical G:U base pairs presented in the plus-sense RNA occur as nonpairing C /A bases in the minus-sense RNA Interestingly, in Puumala hantavirus, a hairpin-like...

5
483
0

báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

Ngày tải lên : 20/06/2014, 04:20

... PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed our earlier ... Molecular Systems) was used To monitor the presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; ... weaker due to the fact that two non-canonical G:U base pairs presented in the plus-sense RNA occur as nonpairing C /A bases in the minus-sense RNA Interestingly, in Puumala hantavirus, a hairpin-like...

5
430
0

Báo cáo y học: "The shunt from the cyclooxygenase to lipoxygenase pathway in human osteoarthritic subchondral osteoblasts is linked with a variable expression of the 5-lipoxygenase-activating protein" doc

Ngày tải lên : 09/08/2014, 08:23

... The decrease in prostaglandin and thromboxane levels is probably the basis for the anti-inflammatory and analgesic activity of the NSAIDs that are widely used for the treatment of OA Newer drugs ... established that they had not been on any medication that could interfere with bone metabolism and had not had any bone metabolic disease Individuals showing abnormal cartilage macroscopic changes and/ or ... was extracted with TRIzol™ reagent (Invitrogen, Burlington, Ontario, Canada) in accordance with the manufacturer's specifications and than treated with the DNA-free™ DNase Treatment and Removal...

10
459
0

Báo cáo y học: "Standards of evidence in chronobiology: critical review of a report that restoration of Bmal1 expression in the dorsomedial hypothalamus is sufficient to restore circadian food anticipatory rhythms in Bmal1-/- mice" pot

Ngày tải lên : 10/08/2014, 09:20

... if asleep) will arouse and orient immediately when the door of their isolation chamber is opened at mealtime to place food in the cage A mouse that has to be physically handled to be aroused is ... that the waveform in Fig S3D (Figs and here) is misaligned and that temperature rises in anticipation of mealtime at least an hour earlier than this figure suggests The data therefore appear to ... the food restriction days that are shown, temperature rises before mealtime, i.e., it displays a rhythm with an anticipatory phase angle To interpret these data, it is necessary to see activity...

13
349
0

Báo cáo y học: "Severe heparin-induced thrombocytopenia: when the obvious is not obvious, a case report" pptx

Ngày tải lên : 11/08/2014, 10:22

... Figure Gangrenous right hand and left foot as they appeared on hospital day #15 Gangrenous right hand and left foot as they appeared on hospital day #15 Type I is non-immune, usually of no clinical ... during hospitalization She was ultimately discharged to a long-term rehabilitation facility, but later died after cardiac arrest No autopsy was obtained Discussion Thrombocytopenia, a commonly ... cyanosis was noted and attributed to the presence of a right radial arterial catheter, which was removed the next day without improvement By then, all toes and fingers showed severe ischemic changes...

5
372
0

Báo cáo y học: " Neutrophil cannibalism – a back up when the macrophage clearance system is insufficient" pot

Ngày tải lên : 12/08/2014, 16:20

... of their gran- It is apparent that neutrophils have the abilities needed to mimic macrophage behaviour; they attend the site of inflammation or infection, have clearance/phagocytosis capacity and ... neutrophils to have a similar phagocytic capacity as macrophages Figure Phagocytosing neutrophils and macrophages in lavage fluid Phagocytosing neutrophils and macrophages in lavage fluid Photomicrographs ... conditions such as infectious pneumonias, ARDS/ALI and COPD-exacerbations However, to gain certainty and further knowledge, additional studies in animal models as well as in clinical situations,...

7
232
0

Báo cáo khoa học: "SOFA is superior to MOD score for the determination of non-neurologic organ dysfunction in patients with severe traumatic brain injury: a cohort study" doc

Ngày tải lên : 13/08/2014, 02:24

... determined the most abnormal value for each parameter The program then calculated the appropriate SOFA value (range 0–4), which was then exported to a local longitudinal ICU database known as TRACER ... ovascular failure was not associated with hospital mortality (P = 0.42) This suggests MOD defined cardiovascular failure is a poor discriminator of outcome rather than SOFA overcalling cardiovascular ... cardiovascular failure due to vasopressor use for cerebrovascular support In general, an increasing SOFA respiratory component score was associated with increasing mortality This was not the case for the...

10
388
0

Báo cáo y học: "Early down-regulation of the pro-inflammatory potential of monocytes is correlated to organ dysfunction in patients after severe multiple injury: a cohort study" pptx

Ngày tải lên : 13/08/2014, 16:21

... protein plasma levels after trauma reveals associations with the clinical course Acta Anaesthesiol Scand 2001, 45:364-370 Gando S, Nakanishi Y, Tedo I: Cytokines and plasminogen activator inhibitor-1 ... clinical research both as an outcome tool in trials, and in risk adjustment as well as a monitoring device at the bedside It seems reasonable to assume that the intensity of monocytic temporal paralysis, ... of the means is principally given as the standard error of the mean Data are plotted as boxes (interquartile range that contains the 50% of values) with a straight line at the median, a dashed...

11
301
0