when installing the connector connect it firmly with the cable and equip it with a heat shrink tube so as not to expose the bare core and the handle of the connector

Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx

Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx

Ngày tải lên : 19/06/2014, 08:20
... based upon in vitro translation of PMV gRNA in wheat germ extracts (data not shown) Each mutant was tested in foxtail millet (Setaria italica cv German R) protoplasts to examine the effects of ... cytosol Results of replication assays in protoplasts with transcripts of pKB238 and pQP94 validate the conclusion that the CP and movement-associated genes of PMV are dispensable for replication ... millet plants and assay for RNA products Subcellular fractionation and analyses of the PMV replicase proteins isolated from millet plants and assay for RNA products generated by the PMV RNA-dependent-RNA...
  • 12
  • 307
  • 0
Báo cáo y học: "Changes in multi-segment foot biomechanics with a heat-mouldable semi-custom foot orthotic device" pps

Báo cáo y học: "Changes in multi-segment foot biomechanics with a heat-mouldable semi-custom foot orthotic device" pps

Ngày tải lên : 10/08/2014, 21:24
... plantar fascia strain compared to walking without an orthoses While we are not aware of another gait study that has calculated strain within the plantar fascia, the results are consistent with previous ... for the D1MT, NAV, and MCAL markers for the purpose of calculating plantar fascia strain (PFS) and medial longitudinal arch (MLA) angle values The MLA angle was calculated in a manner similar to ... from the head of the first metatarsal (D1MT) to the NAV marker (Figure 4) Plantar fascia strain is a unitless measure calculated by approximating the plantar fascia as spanning between the first...
  • 8
  • 325
  • 0
Installing the Eclipse Web Tools Platform

Installing the Eclipse Web Tools Platform

Ngày tải lên : 05/10/2013, 04:20
... hierarchy, JDBC-related, 171 data-access frameworks, integration with, 139–140 data-access layer, 216 data-access object, 162 database, relational, database data and JdbcTemplate class aggregate ... TransactionProxyFactoryBean, 201–203 in Spring 1.2 @Transactional annotation, 204–209 @Transactional annotation limitations, 207 overview of, 203 in Spring 2.0 @Transactional annotation and autoproxy ... JdbcTemplate class, 175–176 Agile Software Development, Principles, Patterns, and Practices (Martin), 153 AllMembersController, creating, 229–231 AnnotationAwareAspectAutoProxyCreator class, 104 annotations...
  • 32
  • 412
  • 1
Installing the S7-200

Installing the S7-200

Ngày tải lên : 06/11/2013, 08:15
... to pass parameters to and from subroutines and to store intermediate values used in a calculation The S7-200 provides four 32-bit accumulators (AC0, AC1, AC2, and AC3) You can access the data ... the least significant or 16 bits of the value that is stored in the accumulator to access the accumulator as bytes or words To access the accumulator as a double word, you use all 32 bits For ... is not initialized by the S7-200 at the time of allocation and might contain any value When you pass formal parameters in a subroutine call, the values of the parameters being passed are placed...
  • 20
  • 502
  • 0
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Ngày tải lên : 24/12/2013, 01:17
... DataRelation was created are • • Cascade, meaning that changes to the CustomerID DataColumn of customersDT are cascaded to ordersDT This is the default None, meaning that changes to the CustomerID DataColumn ... a DataTable named customersDT There is a row in the Orders table that also has a CustomerID of J6COM A copy of this row is stored in a DataTable named ordersDT The customersDT and ordersDT DataTable ... in the customersDT and ordersDT DataTable objects and also in the Customers and Orders database tables This works as long as you use only the OrderID column in the WHERE clause of the Command...
  • 6
  • 428
  • 0
Tài liệu Installing the Fiber Spool Box ppt

Tài liệu Installing the Fiber Spool Box ppt

Ngày tải lên : 19/01/2014, 10:20
... Position of the Fiber Spool Box Describes the appearance of the fiber spool box 8. 2Installing the Plate and the Box Describes the procedure of installing the plate and the box 8.1 Installation ... 3500 Installation Manual Installing the Fiber Spool Box 8.2 Installing the Plate and the Box Purpose This procedure guides you to install the fiber spool box into the cabinet Tools /Materials Cross ... attenuators If the cabinet holds two OSN 3500 subracks, install the fiber spool box at the third hole from the bottom of the cabinet, more than 50 mm away from the subrack OptiX OSN 3500 Installation...
  • 5
  • 262
  • 0
Tài liệu Installing the COA and DCM pdf

Tài liệu Installing the COA and DCM pdf

Ngày tải lên : 19/01/2014, 10:20
... power cables and the management cables 4 OptiX OSN 3500 Management cable COA power cable SS62COA SS62COA Management cable Figure 1.3 Connection of the power cables and the management cables 7.2.2 ... Describes the connection and the installation of the DCM 7.1 Installing the SS61COA and N1COA This section describes the connection and the installation of the SS61COA The installation of the N1COA is ... the SS61COA Describes the connection and the installation of the SS61COA and N1COA 7. 2Installing the SS62COA Describes the connection and the installation of the SS62COA 7. 3Installing the DCM Describes...
  • 16
  • 576
  • 0
Tài liệu Installing the Cable Distribution Plate docx

Tài liệu Installing the Cable Distribution Plate docx

Ngày tải lên : 19/01/2014, 10:20
... 3500 Installation Manual 6Installing the Cable Distribution Plate cabinet Figure 1.1 Position for mounting ears Cable distribution plate Installation position Cable distribution plate for the lower ... the contents of this chapter Section Description 6.1Installation Position Describes the position of the cable distribution plate in the cabinet 6. 2Installing the Cable Distribution Plate in the ... chapter guides you to install the cable distribution plate One cable distribution plate is delivered with one subrack The cable distribution plate is installed over the subrack The following table...
  • 5
  • 310
  • 0
Tài liệu Báo cáo khoa học: Accessibility changes within diphtheria toxin T domain when in the functional molten globule state, as determined using hydrogen⁄deuterium exchange measurements pdf

Tài liệu Báo cáo khoa học: Accessibility changes within diphtheria toxin T domain when in the functional molten globule state, as determined using hydrogen⁄deuterium exchange measurements pdf

Ngày tải lên : 16/02/2014, 09:20
... exchange is either acid-catalyzed or base-catalyzed [20] As a consequence, the dependence of Log(kexch) (the logarithm of the exchange rate) as a function of the pH is a chevron plot with a minimum ... initiates the translocation of the catalytic domain Here, the data allowed identification of the core of the protein in the N state and the evolution of the overall structure of the protein in the ... the T domain was quite similar to that of the dead volume (Fig 7A) According to a general estimation, the oligomers formed at pH 4.0 are at least 10-mers with an apparent molar weight of around...
  • 10
  • 530
  • 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Ngày tải lên : 20/02/2014, 02:21
... concentration of AT and the rates of interaction in the presence and absence of heparin pentasaccharide (Table 1), one can calculate that the half-life of enzyme activity in the absence of heparin ... of AT with and without the heparin pentasaccharide bound, heparin cofactor II and cleaved protein C inhibitor are shown as indicated In all of the structures, the A b-sheet is shown in red, the ... physiological activator of HC-II has been assumed to be extravascular dermatan sulfate [56–64], which would complement the intravascular effect of heparan sulfate binding to AT Maimone and Tollefsen...
  • 10
  • 668
  • 0
The World with a Thousand Moons pdf

The World with a Thousand Moons pdf

Ngày tải lên : 06/03/2014, 00:20
... air, Walls triggered his atom-pistol The crackling blast of force tore into the body of the charging asteroid-cat, and the beast fell heavily a few yards away But as it fell, the small gray mass ... Kenniston and the Jovian obeyed The Sunsprite was lying sharply canted on its side, and it was difficult to scramble down through the tilted passageways and decks to the big main cabin The cabin was a ... long amid the wild asteroids and moons of the outer planets It was worse up in the glittering cocktail room atop the hotel The place had glassite walls and ceiling, and was designed to give an...
  • 52
  • 408
  • 0
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

Ngày tải lên : 06/03/2014, 01:20
... primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG ... blotting analyses and compared with the data obtained when analyzing the same protein in vitro Because eGFP does affect the solubility, the solubility class used in this case is the one with eGFP As ... As shown in Table 1, eGFP generally decreases the solubility of proteins belonging to classes with a high solubility and increases the solubility of proteins belonging to classes with a low solubility...
  • 11
  • 445
  • 0
Đề tài " The distribution of integers with a divisor in a given interval " ppt

Đề tài " The distribution of integers with a divisor in a given interval " ppt

Ngày tải lên : 06/03/2014, 08:21
... for the prime divisors of n to lie all above their expected values An analogy from probability theory is to ask for the likelihood that a random walk on the real numbers, with each step haveing ... of Mathematics and Informatics, Bulgarian Academy of Sciences Finally, the author acknowledges the referee for a thorough reading of the paper and for helpful suggestions This work was partially ... (7.2) write a = a1 a2 with pβ , a1 = pβ a, β≥2 so that (a1 , a2 ) = and a2 is square-free By Lemma 3.1, L (a; σ) ≤ τ (a1 )L (a2 ; σ) ≤ στ (a1 )τ (a2 ) (7.6) Also (7.7) a1 τ (a1 ) a1 >w −3/4 a1 w−1/4...
  • 68
  • 409
  • 0
Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx

Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx

Ngày tải lên : 07/03/2014, 16:20
... 5¢-aataatccatgg gggcacagcttttatatgagcgcggag-3¢ and 5¢-aataatggatcctcactgttc cttatccgatttttcgaagtgc-3¢ PCR products were doubly digested with NcoI and BamHI (New England Biolabs, Beverly, MA, USA), ... form critical intra- and intermolecular contacts These observations demonstrate the capacity, and on occasion the necessity, of TPRs to participate at all levels of structure organization, and suggest ... orthogonal to the diagonal (helix A interacting with helix B), then parallel to the diagonal (helix A interacting with helix A of the next repeat), and finally returning to the diagonal (helix...
  • 14
  • 433
  • 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Ngày tải lên : 07/03/2014, 17:20
... that the mechanism of release of the axial ligand under alkaline conditions and in the presence of GdmHCl is different Under alkaline conditions release of the axial ligand is postulated to arise ... sensitive to the chemical nature of the axial ligands to the hemeiron [41] Upon replacing the native Met ligand with either an exogenous or protein-based ligand a change in the distribution of the ... for data collection and refinement are summarized in Table The program procheck [34] was used to analyse conformational variations from the defined norms, with the quality of the Ramachandran plots...
  • 15
  • 509
  • 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Ngày tải lên : 08/03/2014, 09:20
... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... been made to use this program for subsite mapping of other a- amylases found in the literature Evaluations of subsite maps of rice and barley a- amylases are thus also presented MATERIALS AND METHODS ... data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to CNP-modified maltooligosaccharide substrates [8] and the open bars depict the subsite map with...
  • 6
  • 387
  • 0
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Ngày tải lên : 08/03/2014, 09:20
... twice and the purity assessed by a MALDI-TOF analysis using a Hewlett Packard G202 5A LD-TOF system mass spectrometer and a- cyano-4-hydroxycinnamic acid as matrix Sample preparation It has been ... polymer-based reversedphase column The column was maintained at 45 °C and perfused at a flow rate of mLÆmin)1 with a mobile phase containing solvent A (5 mM ammonium acetate, pH in 5% acetonitrile), and ... media and, at the same time, it has a helix-promoting ability very similar to that of trifluoroethanol [15,16] MATERIALS AND METHODS Solid phase peptide synthesis and purification Ab-(1–42) was...
  • 7
  • 624
  • 0
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

Ngày tải lên : 08/03/2014, 16:20
... into one peak on a real mass scale, which has a typical peak width at half height of 10–20 average mass units The mass spectrometer was tuned for chromatographic conditions with a lgÆlL)1 solution ... conserved and it may reasonably be assumed that they have similar optical extinction coefficients; therefore the area underlying each HPLC peak allowed a comparison of the relative stoichiometry of each ... quadrupole mass spectrometer equipped with the electrospray ion source [22] For HPLC-MS analysis, with pneumatically assisted electrospray, a spray voltage of kV and a sheath gas pressure of...
  • 9
  • 477
  • 0