... solution The latter has the additional attributes of being available anywhere, at anytime and on any device If it was only a simple as a mouse-trap The complication is that for most customers they already ... when assessing cloud value AMS isthe paradigm where a predefined level of demand is managed internally and the remainder augmented with cloud services The apothegm is ‘Own the base and rent the ... satisfaction A proven change agent, capable of orchestrating transformative business strategy Champions innovation with afocus on developing flexible, scalable solutions for customer and organisational...
... matrix These crystalline grains can be either ‘beta-Sialon’ , ora mixture of ‘alpha’ and ‘beta’ , but generally it can be said that as the ‘alpha’ phase increases, the hardness ofthe ‘Sialon’ ... uncomplicated tooling database for later interrogation Having established the current status ofthe tooling within the manufacturing facility, this allows for a tooling rationalisation campaign to ... in the plant and to amortise such costs (i.e pay-back), isthe most advantageous way forward This strategy can create ‘bottlenecks’ and disrupt the harmonious flow of production at later stages...
... not appear that the errors described above fall into this category Rather, the errors described above are more appropriately characterised as 'lapses of attention' that are unlikely to bias results ... 3201.0) Canberra: Commonwealth of Australia; 2005 ABS: Australian Bureau of Statistics (ABS) Life Tables, Victoria 2002–2004 (Catalogue No 3302.2.55.001) Canberra: Commonwealth of Australia; 2005 ... ABS: Australian Bureau of Statistics (ABS) Census of Population and Housing 2001, Basic Community Profile (Catalogue No 2001.0) Canberra: Commonwealth of Australia; 2002 ABS: Australian Bureau of...
... h a r a n A f r i c a | whatisthe impact of microfinance on poor people? b ackground data on microfinance from Asia and Latin America, making afocus on SSA important for what it might reveal ... evaluations of microfinance programmes within Ethiopia, Ghana, Kenya, Madagascar, Malawi, Rwanda, South Africa, Tanzania (Zanzibar), Uganda and Zimbabwe, and include both rural and urban initiatives ... interventions, and two were of savings schemes alone They include evaluations of programmes within Ethiopia, Ghana, Kenya, Madagascar, Malawi, Rwanda, South Africa, Tanzania (Zanzibar), Uganda and Zimbabwe...
... ideas can flow and flourish, follow some of these basic leadership and management practices 7)Information processing and thinking capacity • The power of your brain is incalculably large The manager ... ofthe communication object This isthe basis ofthe importance of communication, handling conflict and negotiation 4)Communications • The ground rules of communication to became a good Manager ... Cor, meaning heart It means to give courage, confidence or hope Having courage is having the ability to disregard fear and to be brave The easiest way to be brave and fearless is to listen to and...
... goals - and take a fresh start every single day We are careful not to underestimate in any way the people ofthe company, their appetite for change and their ability to hard things Corporate ... types of companies: The flexible ones and the dead (John Naisbitt) We know that people have nothing against change per se Just against the fact of „being“ changed For that reason we pay special attention ... behaviour characterizes our rational and decision making process We believe in being available for each other 24 x and communicating with each other actively Our Sun-down rule says, that all...
... Zelda by Nintendo, Star Wars by George Lucas, The Wizard of Oz by L Frank Baum, The Tragical History of Doctor Faustus by Christopher Marlowe, and the Zen koans "Ganto's Axe" and "One Hand Clapping." ... customizations made." "I see And what about this one? This isa paid theme What you just said makes it sound like paid themes aren't needed Is this a bad theme?" "No, it's a wonderful theme," the ... see And what about this one? This blog has an image for every single post That must be a waste of time Is this a bad use of images?" "No, it's a wonderful use of images," the old man said "Great...
... determined numerical values ofthe ratio a/ b, and isthe theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein ... rotamer normality correspond to Z-scores and therefore a positive value indicates better than average and their maximum values are around The values for all these parameters obtained for the ... good and the programs did not mark any as poor or inappropriate Another structural analysis, obtained by the VERIFY3D program [61], gave an average value of 0.21, which is greater than zero, the...
... conformation (checked against the final coordinates) due to the poor quality ofthe maps, and refinement with refmac5 [29] stalled at R-factors of 26 and 30% This may be due to real disorder in the ... general acid in HsSTP, His62, is shown as sticks with gray carbon atoms the overall conformation ofthe flap subdomain The conformations are correlated with the presence or absence of M3, but Asn160 ... to binding ofa third metal ion The implications ofthe M3 binding and flap subdomain conformations to the catalytic mechanism are discussed below The role ofthe third metal in catalysis In MtSTP...
... estimate ofthe correlation between ordinal variables which uses the assumption that ordinal variables are observed indicators of latent and normally distributed variables The polyserial correlation ... the polychoric or polyserial correlation matrix instead ofthe usual correlation matrix as the starting point ofthe principal component analysis The polychoric correlation matrix isa maximum likelihood ... 30% for males and 24% for females Furthermore, the percentage of individuals who was in poor health at age 10 was 9% among Spanish males and 11% among Spanish females There is less variation between...
... any disclaimer or limitation set forth in this agreement violates the law ofthe state applicable to this agreement, the agreement shall be interpreted to make the maximum disclaimer or limitation ... 501(c)(3) educational corporation organized under the laws ofthe state of Mississippi and granted tax exempt status by the Internal Revenue Service The Foundation's EIN or federal tax identification ... must, at no additional cost, fee or expense to the user, provide a copy, a means of exporting a copy, ora means of obtaining a copy upon request, ofthe work in its original "Plain Vanilla ASCII"...
... degradation of NOS and HSP90 by calpain M Averna et al Table Levels of native and 15 kDa calpastatin species in brain and aorta of NMS and HMS rats treated with HSD for weeks The data reported are ... significant degradation of HSP90, which was only partially B Fig Levels of calpain isoforms and calpain substrates in the aorta of NMS and HMS rats treated with HSD Aliquots (100 lg protein) of brain ... the inactivation and fragmentation of calpastatin are known to be produced by active calpain [32], these observations further indicate that calpain is activated in both tissues, although at a...
... ofthe freedom of movement and whether there actually was a realistic alternative for the transportation ofthe affected goods by other means of transport or via other road routes Moreover, a ... by the Court in accordance with the ‘traditional analytical pattern’ laid down in Dassonville and Cassis de Dijon” as “fully satisfactory” and saw no reason to depart from it.66 “That analytical ... turn, affects the access of that product to the market of that Member State[,]” is also found in paragraph 56 of Commission v Italy, in paragraph 57 the Grand Chamber made it clear that the measure...
... Two authors x chose to work with co-authors All authors’ names and organizational affiliations are listed at the beginning of each ofthe chapters in Part Two Each author or team of co-authors ... Education Standards In 1999, Gallagher was awarded the Distinguished Service Award by the National Association for Research in Science Teaching He also isa Fellow ofthe American Association for ... well as professional organizations So the way we have organized and assigned the authors to analyze the research is in these five areas: learning; teachers and teaching practice; curriculum; teacher...
... use the formula A = r2 r ■ To find the area ofa parallelogram, use the formula A = bh h b ■ To find the area ofa rectangle, use the formula A = lw w l ■ To find the area ofa square, use the formula ... (the median), and /or the average of all the values (the mean) M EAN AND M EDIAN To find the average, orthe mean, ofa set of numbers, add all the numbers together and divide by the quantity of ... a cylinder, use the formula V = r2h h r S URFACE A REA The surface area of an object measures the combined area of each of its faces The total surface area ofa rectangular solid is double the...
... pairs at the stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These ... Molecular Systems) was used To monitor the presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; ... manuscript Acknowledgements 18 19 The authors thank Prof Åke Lundkvist for fruitful discussion and Prof Antti Vaheri for general support This work was supported by the research grants RFA915 and...
... 5’-CAACGAGCCACATATGCGGATTAC-3’); IL-1β, (5’-TCATGGGATGATAACCTGCT-3’ and 5’-CCCATACTTTAGGAA- GACACGGAT-3’); IFN-α, (5’-ACCTCCTCTGACCCAGGAAG -3’ and 5’-GGCTCTCCAGACTTCTGCTC-3’); IFN-β, (5’-CCCTATGGAGATGACGGAGA-3’ ... (5’-CCCTATGGAGATGACGGAGA-3’ and 5’-CTGTCTGCTGGTGGAGTTGA-3’); IFN-γ, (5’-ACTGGCAAAAGGATGGTGAC-3’ and 5’-TGAGCTCATTGAATGCTT GG-3’); IL-10, (5’-GCCAAGCCTTATCGGAAATGATCC-3’ and 5’-AGACACCTTGGTCTTGGAGCTT-3’); ... (5’-CTGTGAAGGGAATGGGTGTT-3’ and 5’GGTCACTGTCCCAGCATCTT-3’); IL-6, (5’-AGTTGCCTTCTTGGGACTGA-3’ and 5’TCCACGATTTCCCAGAGAAC-3’); IL-17, (5’-GGGGATCCATGAGTCCAGGGAGAGC-3’ and 5’-CCCTCGAGTTAGGCTGCCTGGCGGA-3’);...
... pairs at the stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These ... Molecular Systems) was used To monitor the presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; ... manuscript Acknowledgements 18 19 The authors thank Prof Åke Lundkvist for fruitful discussion and Prof Antti Vaheri for general support This work was supported by the research grants RFA915 and...