what is the soil like in a tropical rainforest biome

Báo cáo khoa học: "A comparison of five indirect methods for characterizing the light environment in a tropical fores" pptx

Báo cáo khoa học: "A comparison of five indirect methods for characterizing the light environment in a tropical fores" pptx

Ngày tải lên : 08/08/2014, 14:21
... yet are able to assess temporal and spatialrelativevariations. The relationship between a variable measured at the sampling point and the same variable measured with a small spatial displacement, ... transects. The first 8 variables are “openness” variables, whereas the remaining 7 variables are “foliage” variables. Shaded areas indicate the couples of variables that are issued from a common device ... in - vadedbylianasandsaplingsthat contribute heavilytothe LAI although their basal area is not taken into account in our inventories. Thus, light availability may decrease in logged plots due to shading...
  • 16
  • 317
  • 0
What is the price of a mousetrap? The assessment of value from cloud services pptx

What is the price of a mousetrap? The assessment of value from cloud services pptx

Ngày tải lên : 09/03/2014, 02:20
... solution. The latter has the additional attributes of being available anywhere, at anytime and on any device. If it was only a simple as a mouse-trap. The complication is that for most customers they ... corporation Conclusion In this ebook, I discuss one functional transformation that has taken placed as a result of cloud services, namely; the impact on the assessment of value. This is a timely discourse as the ... the traditional performance measure are absurd. It is pure guesswork to forecast IT demand over a multi-year period and translate that back to IT costs. How many and what types of servers are...
  • 3
  • 507
  • 0
Geochemistry of inorganic arsenic and selenium in a tropical soil  effect of reaction time, ph, and comp

Geochemistry of inorganic arsenic and selenium in a tropical soil effect of reaction time, ph, and comp

Ngày tải lên : 16/03/2014, 00:25
... particles. This soil is grouped as gravelly clay loam in accordance with the USDA soil classification system. The characteristics of the tropical soil used in this study are shown in Table 1. It can be seen ... 857 the potential groundwater and surface water contami- nation by these contaminants. Arsenic can exist in inorganic form, organic form, and gaseous state. The oxidation states of As in the natural ... 1ị where S is the adsorption of the adsorbate (%); C 0 is the initial concentration of the adsorbate in the soil- less blank (mg/l); C f is the final concentration of the adsor- bate in the filtrate (mg/l). Sðmg=kg...
  • 11
  • 832
  • 0
in prostate tests psa what is the difference between total psa and free psa

in prostate tests psa what is the difference between total psa and free psa

Ngày tải lên : 21/03/2014, 12:19
... that there is no prostate cancer? Doesn’t the existence of any PSA means that the body is reacting with antibodies against cancerous cells in the prostate. PSA starts out in the fluid that carries ... In prostate tests PSA what is the difference between total PSA and free PSA? What is the normal range? In addition, how can it be that if there is ANY prostate specific antigen in the blood ... prostate enlargement, inflammation, infection, age, and race. If there are no other indicators that suggest cancer, the doctor may recommend repeating DRE (digital rectal examination) and PSA...
  • 4
  • 563
  • 0
What is the impact of microfinance on poor people? a sysTemaTic review of evidence from sub-saharan africa pptx

What is the impact of microfinance on poor people? a sysTemaTic review of evidence from sub-saharan africa pptx

Ngày tải lên : 22/03/2014, 21:20
... Practice Information and coordinating Centre FINCA Foundation for International Community Assistance FSDT Financial Sector Deepening Trusts in Kenya and Tanzania GHAMFIN Ghana Microfinance Institutions ... were of savings schemes alone. They include evaluations of programmes within Ethiopia, Ghana, Kenya, Madagascar, Malawi, Rwanda, South Africa, Tanzania (Zanzibar), Uganda and Zimbabwe. Ten ... African countries, namely Cameroon, Ethiopia, Ghana, Kenya, Ivory Coast, Madagascar, Malawi, Nigeria, Rwanda, South Africa, Tanzania, Uganda, Zambia and Zimbabwe. One study also included data...
  • 104
  • 546
  • 0
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

Ngày tải lên : 23/03/2014, 04:20
... A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut E Mut F Mut G Mut H Mut I ABCDEFG ... to LIN54 [34]. Although A B MYB2 MYB3 MYB4 MYB5 E2F CAAT CAAT CDE CHR MYB1CHR ABCDE GHIF ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTTAAGATCT CHRup MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut...
  • 14
  • 456
  • 0
INDUSTRY SURVEY - What future animators say about what they are looking for in a school, and what professional animators say are the most important things to look for. ppt

INDUSTRY SURVEY - What future animators say about what they are looking for in a school, and what professional animators say are the most important things to look for. ppt

Ngày tải lên : 31/03/2014, 15:20
... curriculum as their top picks. Canada also highly valued individual attention, as did Italy at 50% and the United Kingdom at 41%. Brazil, India and Spain chose having an innovative teaching/learning ... professional animator. They also state the importance of creating and maintaining a professional network. One in ve animators say they have a mentor at work, while having a mentor is in the top ... Kelly, Carlos Baena, Keith Sintay, Aaron Gilman and Wayne Gilbert. ANIMATION TIPS AND TRICKS, VOLUME II Behind the Characters: Job Satisfaction, Career Outlook and Salary Survey is an industry...
  • 14
  • 465
  • 0
– GED SOCIAL STUDIES PRACTICE QUESTIONS – 29. What is the author’s purpose in including Joe pot

– GED SOCIAL STUDIES PRACTICE QUESTIONS – 29. What is the author’s purpose in including Joe pot

Ngày tải lên : 18/06/2014, 17:20
... Mat- ter can also refract or bend waves. This is what happens when a ray of light traveling through air hits a water sur- face. A part of the wave is reflected, and a part is refracted into the water. Maximum ... by the passage. 53. b. Ch in Shih Huang-ti abolished the aristocracy of feudalism, instead appointing officials to carry out his rules in all of China’s provinces. 54. e. The Ch in Dynasty introduced ... graph. It lists the symbols used to label a particular data set. Bar graphs are similar to scatter plots. Both have a variable y plotted against a variable x. However, in bar graphs, data is represented...
  • 48
  • 775
  • 0
Cutting Tool Materials What is the use of a book docx

Cutting Tool Materials What is the use of a book docx

Ngày tải lên : 27/06/2014, 23:20
... onto an uncomplicated tooling database for later in- terrogation. Having established the current status of the tool- ing within the manufacturing facility, this allows for a tooling rationalisation ... machining operations it can be considered as a ultra-hard cutting tool, it was rst synthesised in the late 1950’s. In many ways, CBN and natural diamond are very similar materials, as they ... Parts, American Machinist, May 1996. Raymond, M.K. Coatings Keep Cutting Tools Sharp. Ameri- can Machinist, 40–42, May 1996. Richter, A. Raising Al – AlTiN Coatings. Cutting Tool Engg., 42–46, Jan.,...
  • 31
  • 455
  • 0
Báo cáo lâm nghiệp: " Quantification of nutrient content in the aboveground biomass of teak plantation in a tropical dry deciduous forest of Udaipur, Indi" pdf

Báo cáo lâm nghiệp: " Quantification of nutrient content in the aboveground biomass of teak plantation in a tropical dry deciduous forest of Udaipur, Indi" pdf

Ngày tải lên : 07/08/2014, 03:22
... Winters are a little cold with the maximum temperature rising to 26.8°C and the minimum dropping to 2.5°C. e average annual rainfall of the area is 610 mm. Approximately 90% of the rainfall ... aboveground biomass of teak plantation in a tropical dry deciduous forest of Udaipur, Rajasthan, India. e nutrient contents in the total biomass of teak in the plantation were 165.47 kg/ha ... Academic Publishers: 73–80. NAMBIAR E.K.S., BROWN A. G., (eds), 1997. Management of Soil, Water and Nutrients in Tropical Plantation Forests. Australian Centre for International Agricultural...
  • 6
  • 353
  • 0
Báo cáo khoa học: "Soil CO in a beech forest: 2 efflux the contribution of root respiration Daniel" pptx

Báo cáo khoa học: "Soil CO in a beech forest: 2 efflux the contribution of root respiration Daniel" pptx

Ngày tải lên : 08/08/2014, 14:21
... coring and sorting remaining dead roots in the trenched plots 2 years after trenching. The remaining fine root necromass was then compared to initial fine root biomass and necromass ... remaining fine root necromass 2 years after trenching to initial fine root biomass and necromass indicated that 53 % of killed fine roots disap- peared within 2 years ... (1993) 1402-1407. [5] Bréda N., Granier A. , Barataud F., Moyne C., Soil water dynamics in an oak stand. Part I. Soil moisture, water poten- tials and water uptake by roots, Plant Soil 172...
  • 7
  • 368
  • 0
Báo cáo y học: "Value of anti-infective chemoprophylaxis in primary systemic vasculitis: what is the evidence" pdf

Báo cáo y học: "Value of anti-infective chemoprophylaxis in primary systemic vasculitis: what is the evidence" pdf

Ngày tải lên : 09/08/2014, 14:22
... treatment in a large GCA trial and increased infection-related mortality. Rising awareness of GC complications, including infections, makes GC sparing an increasingly important aim. According to ... promotes infections but has a role in the aetiology of the disease itself [44]. Disease stage and phase of therapy In PSV, and especially in SVV, the therapeutic approach usually consists of an induction ... non- absorbable and associated, therefore, with very few side effects. According to a meta-analysis, the non-absorbable nystatin is not more effective in avoiding fungal colonisation than placebo and can...
  • 11
  • 451
  • 0
báo cáo khoa học: "An attempt to modify allelic frequencies at the Adh locus of a Drosophila melanogaster population in a tropical environment" pot

báo cáo khoa học: "An attempt to modify allelic frequencies at the Adh locus of a Drosophila melanogaster population in a tropical environment" pot

Ngày tải lên : 09/08/2014, 22:23
... genetically marked by a rare biochemical allele was released in a small, isolated natural population in tropical Africa. Surprisingly, only a slight, short-term modification was ... p. 100 in tropical Africa (DAVID, 1982). This locus is particularly interesting since many investigators have tried to deter- mine if its polymorphism is maintained by selective ... of the third sample. This was, however, a transient phenomenon, disappearing in the next generation. Again two explanations may be considered : (1) massive arrival of indigenous...
  • 6
  • 251
  • 0