what does 4 of a kind score in cribbage

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Ngày tải lên : 07/03/2014, 16:20
... s a template and the primers RRTorA-SacI-fw (5Â-GCGCG GAGCTCAAGAAGGA AGAAAAATAATGAAC-3Â, SacI site underlined) and TorA/Lep2-BamHI-rv (5Â-GCAT GGATCCCGCGCGC TTGATGTAATC-3Â, BamHI site underlined). ... (5Â-ACGC GGATCCAG TCATAAACAGCGGTTGC-3Â, Bam HI site un derlined), 87SufI-BamHI-rv (5 Â-ACGC GGATCCAACATCGTCGC CCTTCCA-3Â, BamHI site underlined) and SufIHA- XbaI+ClaI-rv (5Â-ACTG ATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC- ... +31 2 0 44 47175, E-mail: joen.luirink@falw.vu.nl Abbreviations: HA, hemagglutinin; Tat, twin-arginine translocation; TF, trigger factor; OmpA, outer membrane protein A; TorA, tri- methylamine N-oxide...
  • 9
  • 393
  • 0
The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx

The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx

Ngày tải lên : 08/03/2014, 23:20
... offers some additional, if smaller, potential for E and GHG gains (and again data for the Canadian food system is lacking) and a significant body of literature has examined relative E and GHG efficiency ... Sustainability 2011, 3 339 De Bakker et al. [ 84] , examining leeks in Belgium in a full LCA analysis, concluded ―that the total climate change indicator score, Global Warming Potential, ... of Canning et al. [1] (Canadian data is sorely needed), that farm E use represents a gross average of 35% of total food chain E use and continues to increase, an improvement of 20% or more in...
  • 41
  • 524
  • 1
Sensor-based navigation of a mobile robot in an indoor environment

Sensor-based navigation of a mobile robot in an indoor environment

Ngày tải lên : 23/10/2013, 15:15
... data base and starting again the plan- ning [15]. In fact the main penalization due to un- known obstacles is the decreasing of the linear speed of the robot. 5. Conclusion We are interested in ... coordination of S1 and another elementary behavior of wall-following type including the creation of transition sub-goals develop a second strategy S2. As a matter of fact, the idea is to antic- ipate in ... navigation of a mobile robot in partially known environment such as inside an of- fice or a flat. In such cases, a plan of the evolution zone of the robot containing most of its fixed features can...
  • 18
  • 431
  • 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Ngày tải lên : 22/02/2014, 04:20
... in cold adaptation of an alkaline phosphatase Konstantinos Mavromatis 1, *, Iason Tsigos 2, *, Maria Tzanodaskalaki 2 , Michael Kokkinidis 1,3 and Vassilis Bouriotis 1,2 1 Department of Biology, ... encoding alkaline phosphatase from the Antarctic strain TAB5 [16]. Based on the crystal structure (at 2 .4 A ˚ )ofanEscherichia coli alkaline phospha- tase variant with a 28% amino-acid sequence identity ... group of Ala261 side-chain could produce steric clashes with the aromatic ring of Tyr269, and these unfavorable interactions could lead to a decrease of local flexibility and an increased E a value. The...
  • 6
  • 488
  • 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Ngày tải lên : 08/03/2014, 09:20
... Bioscience (Maarsen, the Netherlands). Bacterial strains The E. coli K-12strainsusedinthisstudyarelistedin Table 1. Strains CE15 14 and CE1515 were obtained by P1 transduction using strain CE12 24 as the ... SRP-dependent co-translational targeting and SecA-de- pendent translocation analyzed as individual steps in the export of a bacterial protein. EMBO J. 19, 641 9– 642 6. 43 . Powers, T. & Walter, P. (1997) ... one at  110 kDa and one at  46 kDa (Fig. 4A, lane 3). The 110-kDa complex could be immunoprecipitated with antiserum directed against SecA, indicating that it is a complex of the radiolabeled...
  • 8
  • 546
  • 0
The Project Gutenberg EBook of A First Book in Algebra, pot

The Project Gutenberg EBook of A First Book in Algebra, pot

Ngày tải lên : 15/03/2014, 00:20
... subtracted from 5a to obtain 2a? 5a − 3a =? What must be added to − 3a to obtain 4a? What then must be subtracted from 4a to obtain − 3a? 4a − 7a =? What must be added to 3a to obtain − 2a? What then must ... 3) 4 . 29. John has 4a horses, James has a times as many as John, and Charles has d less than five times as many as James. How many has Charles? 30. A man bought a pounds of meat at a cents a pound, ... then must be subtracted from − 2a to obtain 3a? (− 2a) − (− 5a) =? What must be added to a to obtain − 4a? What then must be subtracted from − 4a to obtain a? (− 4a) − (− 3a) =? Examine now these results...
  • 189
  • 432
  • 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Ngày tải lên : 15/03/2014, 00:20
... ParA1 treatment. H 2 O, H 2 O pretreatment; H + ParA1, ParA1 in ltration after H 2 O treatment; A4 00, 40 0 lM ABA pretreatment; A + ParA1, ParA1 in ltration after ABA treatment. All the spectra were ... respectively, was obtained by PCR with the following oligonucleotide prim- ers: 5Â-TGAATTC AATAATGTCTAACTTCCGCGCTCT- GTTC-3Â and 5Â-AGGTACCTCAATGATGATGATGAT GATGATGCAGTGACGCGCACGTAGA-3Â. For the ... Key Laboratory of Monitoring and Management of Crop Diseases and Pest Insects, Ministry of Agricuture of R. P. China, Department of Plant Pathology, College of Plant Protection, Nanjing Agricultural...
  • 15
  • 479
  • 0
Báo cáo khoa học: Contribution of a central proline in model amphipathic a-helical peptides to self-association, interaction with phospholipids, and antimicrobial mode of action ppt

Báo cáo khoa học: Contribution of a central proline in model amphipathic a-helical peptides to self-association, interaction with phospholipids, and antimicrobial mode of action ppt

Ngày tải lên : 23/03/2014, 10:21
... a Pro with an Ala maintained or decreased the antimicrobial activity but significantly increased the hemolytic activity. In addition, Oh et al. [38] reported that a cecropin A magainin II hybrid ... Percentage hemolysis was calculated using the following formula: % hemoly- sis ¼ [ (A 41 4 in the presence of peptide solution ) A 41 4 in NaCl ⁄ P i ) ⁄ (A 41 4 in 0.1% Triton X-100 ) A 41 4 in NaCl ... Inc., Ottowa, Canada). Calcein- containing vesicles were separated from free calcein by gel filtration chromatography in Tris ⁄ HCl buffer using a Sephadex G-50 column (Pharmacia, Uppsala, Sweden)....
  • 15
  • 376
  • 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

Ngày tải lên : 28/03/2014, 23:20
... thaliana OsSGT1 O. sativa UGT74F1 A. thaliana UGT74F2 A. thaliana NtGT2 N. tabacum UGT75C1 A. thaliana UGT75B1 A. thaliana UGT75D1 A. thaliana UGT84B1 A. thaliana UGT8 4A1 A. thaliana FaGT2 Fragariaxananassa UGT78D1 ... Fragariaxananassa UGT78D1 A. thaliana UGT8 6A1 A. thaliana UGT8 7A1 A. thaliana UGT8 3A1 A. thaliana UGT8 2A1 A. thaliana UGT8 5A1 A. thaliana SbHMNGT S. bicolor UGT76D1 A. thaliana UGT76E1 A. thaliana S39507 ... lycopersicum UGT76F1 A. thaliana CAO69089 V. vinifera UGT76B1 A. thaliana UGT76C1 A. thaliana UGT71B1 A. thaliana CaUGT1 C. roseus UGT71C1 A. thaliana UGT71D2 A. thaliana UGT8 8A1 A. thaliana UGT72E2 A. thaliana UGT72E3...
  • 11
  • 661
  • 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot

Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot

Ngày tải lên : 30/03/2014, 15:20
... (Pickering, Ontario, Canada). All other chemicals were of analytical grade and were obtained from Sigma-Aldrich and Fisher Scientific (Nepean, Ontario, Canada). Bacterial strains and plasmids Strains ... University of Guelph, Ontario, Canada Microbial degradation of aromatic compounds is important for maintaining the global carbon cycle and also for the bioremediation of man-made aromatic compounds, ... protein util- izing the principle of protein-dye binding. Anal Biochem 72, 248 –2 54. 28 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature...
  • 9
  • 461
  • 0
báo cáo hóa học: " Logistic feasibility of health related quality of life measurement in clinical practice: results of a prospective study in a large population of chronic liver patients" potx

báo cáo hóa học: " Logistic feasibility of health related quality of life measurement in clinical practice: results of a prospective study in a large population of chronic liver patients" potx

Ngày tải lên : 18/06/2014, 19:20
... scoring and graphical output of the data, instant availability of data to physicians, guaranteing patient privacy) b) by observing patients' ability to com- plete the HRQoL questionnaires and ... decades ago a committee of the American Col- lege of Physicians specifically supported the view that maintenance of a patient's functional well-being is a fun- damental goal of medical practice. ... results, standard measurement and feedback of HRQoL has as of yet not been widely implemented in clinical practice. This may be explained by the initial lack of convincing data regarding the effectiveness...
  • 9
  • 477
  • 0
báo cáo hóa học: " A randomized trial of a lifestyle intervention in obese endometrial cancer survivors: quality of life outcomes and mediators of behavior change" pptx

báo cáo hóa học: " A randomized trial of a lifestyle intervention in obese endometrial cancer survivors: quality of life outcomes and mediators of behavior change" pptx

Ngày tải lên : 18/06/2014, 19:20
... demographic and clinical data was obtained at baseline and prior to randomization. QOL and self-effi- cacy were assessed at baseline and at 3, 6, and 12 months. Eating behavior and depression was assessed ... or chi-square test for proportions. Primary analysis used repeated measures analysis of variance (ANOVA) with the 3, 6 and 12 month data as outcomes and the appropriate baseline measurement as a covariate ... only at base- line and 12 months. QOL was measured by the Functional Assessment of Cancer Therapy-General (FACT-G), a valid and reliable questionnaire evaluating physical, func- tional, family-social,...
  • 9
  • 443
  • 0
Báo cáo sinh học: " Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene" potx

Báo cáo sinh học: " Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene" potx

Ngày tải lên : 19/06/2014, 08:20
... CATACATGGG GTTGAAAGAA GT TGG-AT TGAAGAAGTT GACAAAGAGG CAAGGAAAAC CATGGCCTCA GCTACAAAGG ACAACTCAGG 44 4 aMPV /A/ UK/3b GATGTA-GGT GTTGGGTGGG CTGATGATGT CGAAAGGACT ACAAGAGAAG CAATGGGAGC AATGG TTA ... ______________________________ aMPV/C/US/Co GGGACAAGTG AAAATGTCTC TTCAGGGGAT TCAGCTTAGT GACTTGTCCT ATAAGCATGC AATCCTTAAA GAATCACAGT ACACAATCAA 90 aMPV /A/ UK/3b GGGACAAGTC AAAATGTCTC TTGAAAGTAT TAGACTCAGT GACTTGGAGT ACAAACATGC ... TTA GGGAAAAAGT GCAACTCA 44 3 aMPV/C/US/Co ACCAATACCA CAAAATCAAA GACCATCATC CCCGGATGCT CCTATCATAC TACTCTGCAT AGGAGCATTA ATCTTCACGA AGCTGGCATC 5 34 aMPV /A/ UK/3b CAA -AGAATCAAA AGCCGTCTGC CTTGGATGCT...
  • 9
  • 438
  • 0