weisberger barbara c 1926— american ballet dancer and company administrator
Báo cáo lâm nghiệp: "Results of Czech-American cooperation in interspecific fir hybridization in 2008 and 2009" pot
... polymix of these clones collected in 2006 In Czech seed orchards the pollen of Abies cilicica × Abies cephalonica hybrid (clones CZ1 and CZ2) was collected This pollen from seed orchard No has been ... 2009 91 CZ1 × NC52 11 – – – CZ1 × NC73 – 11 – – – CZ1 × NC136 – – – – CZ2 × NC136 – – – – – CZ1 × NC84 – – – – CZ1 × PC – – – – CZ2 × PC – – – – CZ1 × A bal – – – – – CZ1 × A fras – – – – – CZ2 × ... to trace any trend in performance of any hybrid combination The most successful hybrid combination CZ1 × NC73 brought 16% of viable seeds CZ1 × PC (10%), CZ1 × NC136 (7%) and CZ2 × PC (4%) can...
- 9
- 508
- 0
Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt
... general and conflict, peace, and security are Public Sector and Civil Society (ii) CAF: Agricultural infrastructure and transport, storage, and communications are Infrastructure; mining and quarrying ... and gas, and productive sectors are Productive Sector; education, social services, and health are Education, Health, and Social Services; computing, other services, regional body and multisector ... Infrastructure; agriculture, forestry, fishing, manufacturing, and tourism are Productive Sectors; social and personal services are Education, Health, and Social Services; and financial is Financing and...
- 35
- 481
- 0
Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf
... ADPinduced platelet aggregation Proc Natl Acad Sci USA 95, 8070–8074 ´ Gachet C, Hechler B, Leon C, Vial C, Leray C, Ohlmann P & Cazenave JP (1997) Activation of ADP receptors and platelet function ... thrombin-induced Ca2+ integral with an IC50 of approximately 10 nm and lm, respectively, which is in accordance with the known affinity of these compounds for the PI3-K catalytic subunits At these concentrations ... consent; subjects were free from medication for at least weeks Blood was collected into a : volume of acid-citrate glucose solution (80 mm trisodium citrate, 52 mm citric acid and 180 mm glucose)...
- 15
- 565
- 0
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
... treatment can be connected with the facts that modification of particular sites in the genome of living cells is naturally stochastic on the one hand, and influenced by the actual structural and functional ... ‘activated’ forms [33] Recently, it has been reported that accessibility of the p53 CTDBS is critical for (sequence-nonspeci c) cisPtDNA recognition [34] On the other hand, sequencespeci c binding of p53 ... how the checkpoint proteins decide which pathway to activate Particularly, no unambiguous correlation between wild-type p53 expression and cancer cell susceptibility to cisplatin-induced apoptosis...
- 14
- 597
- 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... ATnI1F (5¢-CATATCACCATGGGTTCCCTTG-3¢) and ATnI292R (5¢-CTTGATTTGGATCCTTTAAGGTA TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ATnI130F (5¢-GCCAGAA CCATGGCGGAGGAAC-3¢) and ATnI292R, ... back muscle of rabbit by RT-PCR using the primer set, RTnI1F (5¢-CAAACCTCACCATGGGAGAT GAAG-3¢) and RTnI181R (5¢-CCCCGGAGCCGGATCC CCAGCCCC-3¢) These primers were designed based on the sequence ... (5¢-GAGCATGGCGGGAT CCTACATGCGCAC-3¢) and RTnI96F (5¢-GCTGGAGG CCATGGACCAGAAGC-3¢) and RTnI181R, respectively (BamHI ⁄ NcoI sites and termination ⁄ initiation codons are indicated by underlines and bold...
- 12
- 514
- 0
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt
... 5¢-GGACGATGCCACCAGTGCCCTG GACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGCGTC CAGGGCACTGGTGGCATCGTCC-3¢ and complementary primers 5¢-GGATGAGGCTACCAGTGCCCT GGATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATC CAGGGCACTGGTAGCCTCATCC-3¢ for ... the complementary primers 5¢-GGACGATGCCACCAGTACTCTG GATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATCC AGAGTACTGGTGGCATCGTCC-3¢ and for TAP2 the complementary primers 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ ... sequence with site-directed mutagenesis Therefore, we used the complementary primers 5¢-GGATGAGGCTACCAGTGC TC TGGACGCCTAG TGCGAGCAGGC-3¢ and 5¢-GCCTGCTCGCACTAGG CGTCCAGAGCACTGGTAGCCTCATCC-3¢ All...
- 16
- 407
- 0
Tài liệu C++ Lab 7 Post-Test and ested Loops pdf
... You can see how simple it is to implement this using a for loop, because they both (inner and outer) are counter-controlled Program 7-4 #include #include using namespace std; ... were to calculate gross pay for an employee as given below) to calculate gross pay for all employees Exit the outer loop when “quit” is entered for the name input Write a program to calculate ... a multiplication table for the number Program 7-2 #include #include using namespace std; int main() { int tableFor =2; int multiplier=1; while (multiplier
- 7
- 384
- 0
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt
... NapC_Rsph CymA_Sput NrfH_Ddes NrfH_Sdel NrfH_Wsuc Cytc_Dgig Cytc_Ddes 110 L ECRNCHNF E L ECRNCHSAE L ECRNCHAAV L ECRNCHSEV ANCQHCHT RI ANCKACHT QT CI S CHQS L CI SCHASL CHNI L CHANT ... biochemical characterization In conclusion, we have shown that the proposed Mossbauer spectra simulation, based on the actual bio¨ chemical characterization of D desulfuricans ATCC 27774 ccNiR complex ... predicted a lipid attachment to Cys24 The deduced amino-acid sequence of NrfA contains four classical c- type heme-binding motifs CXXCH and a fifth heme-binding site CWXCK [17] The predicted molecular...
- 12
- 593
- 0
A JOINT PROJECT OF THE AMERICAN ACCOUNTING ASSOCIATION AND THE ACCOUNTING PROGRAMS LEADERSHIP GROUP pdf
... the Supply and Demand for Accounting Ph.D.s 25 TABLE 16 Pre-Ph.D Work Experience Number Public Accounting Auditing and assurance services Tax services Other public accounting Other Accounting Private ... Public Accounting Certified Public Accountant Chartered or Certified General Accountant Certified Management Accountant Certified Internal Auditor Certified Fraud Examiner Other professional certifications ... Supply and Demand for Accounting Ph.D.s 38 Financial accounting specialty is in highest demand across all three types of school 40.3 percent of Ph.D Schools’ expected hiring is in financial accounting...
- 63
- 458
- 0
Contemporary American Literature Bibliographies and Study Outlines pot
... Contemporary American Literature, by CONTEMPORARY AMERICAN LITERATURE BIBLIOGRAPHIES AND STUDY OUTLINES BY JOHN MATTHEWS MANLY AND EDITH RICKERT NEW YORK HARCOURT, BRACE AND COMPANY COPYRIGHT, ... at Chicago, 1867 Educated in Chicago public schools Began newspaper work as reporter, 1885 On Chicago Evening Post and Chicago Times Herald, 1892-7 Editor of the Chicago Journal, 1897-1900 Since ... local groups of writers The classification according to subject matter (including the use of local color and background), although it is necessarily incomplete, will, it is hoped, suggest courses...
- 125
- 353
- 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx
... sequence is identified as Y7.53 Construction of mutated B1wt, B2wt and of the B1 ⁄ B2 receptor chimera Standard PCR techniques using either receptor-speci c or chimeric primers with the B1wt and ... intact cells Biol Chem 385, 835–843 21 Marchese A, Chen C, Kim YM & Benovic JL (2003) The ins and outs of G protein-coupled receptor trafficking Trends Biochem Sci 28, 369–376 22 Kalatskaya I, Schussler ... three times with ice-cold PBS and incubated on ice with 0.15 or 0.3 mL of ice-cold incubation buffer [40 mm Pipes, 109 mm NaCl, mm KCl, 0.1% (v ⁄ v) glucose, 0.05% (v ⁄ v) BSA, mm CaCl2, pH 7.4; degradation...
- 12
- 595
- 0
C++ Lab 10 Structures (Struct) and Files pot
... getline(cin,piece.description); cout>piece.price; void showItem (InvItem piece) { cout
- 6
- 574
- 1
The American Game BASEBALL AND ETHNICITY potx
... German American sportswriter F C Richter, devoted considerable space to American Association baseball Cincinnati and St Louis, and later Chicago, promoted players of German ancestry as gate attractions ... difficult existence; and, for many, the game provided a measure of acceptance, a platform on which one could stand proudly and proclaim his status as an American The American Game: Baseball and ... them and, indeed, bound all six subjects, as best we can tell Chadwick and Spalding (and Cartwright, Adams, Harry Wright, and Ward) shared a characteristically British -American morality —Christian...
- 233
- 341
- 0
Báo cáo khoa học: Selective modulation of protein C affinity for EPCR and phospholipids by Gla domain mutation pdf
... range 7.2–115 nM) (C) Complete EPCR ⁄ protein C binding cycle 1, Wildtype sEPCR (800 ng) was injected across the flow cell of a CM5 sensor chip coated with RCR-2 sEPCR was injected for at a flow ... USA) Vector construction and expression of recombinant protein C The full-length protein C cDNA was cloned into the vector pRc ⁄ CMV (Invitrogen, Paisley, UK) to generate 104 Protein C concentrations ... surface of a CM5 sensor chip, and sEPCR captured onto one of the two flow cells of the sensor chip To investigate the nature of RCR-2 binding to sEPCR, recombinant wild-type sEPCR and several sEPCR...
- 12
- 409
- 0
C#1 introduction to programming and the c language potx
... 10 Excellent Economics and Business programmes at: Please click the advert “The perfect start of a successful, international career.” CLICK HERE to discover why both socially and academically ... Perimeter and area of a circle As an example I will show an application, where the user must enter the radius of a circle, and the program calculates and writes the circle’s circumference and area ... text document that contains all the necessary commands his document is called the programs code or source code he individual commands must be written in a very precise way, that the computer can...
- 30
- 538
- 0
Nicolai josutis the c++ standard library a tutorial and reference
... the technical background for this book and the library, such as new language features and the concept of complexity • Chapter 3: General Concepts This chapter describes the fundamental concepts ... the type matches exactly, the implicit copy constructor is generated and called For example: template class MyClass { public: //copy constructor with implicit type conversion //- does ... until a catch clause "catches" and handles the exception: int main() { try { f(); } catch (const Error&) { dyne-book 19 The C+ + Standard Library } //handle exception } Here, any exception...
- 642
- 408
- 1
Object oriented programming with C++ - Session 3 Function Overloading and References ppt
... function is called like func(xobject), while a member function is called like xobject.func() • Designer can select the syntax that is considered most readable Object Oriented Friend classes Declare ... function declaration class first{ public: void display(); }; class second{ public: void display(); }; Object Oriented Scope rules (Contd.) void main() { first object1; second object2; object1.display(); ... Friend classes (Contd.) class beta{ public: void display(alpha d) {cout
- 35
- 688
- 0
Object oriented programming with C++ - Session 6 Multiple Inheritance and Polymorphism pot
... Programming with C+ + / Session / of 44 Constructors (Contd.) class Teach_asst: public Teacher,public Student { private: int z; public: Teach_asst():Teacher(),Student() //constructor {z = 0;} Teach_asst(int ... • Constructors and Destructors s Use Pointers to Objects to access Member Functions Object Oriented Programming with C+ + / Session / of 44 Session Objectives(Contd.) s Describe Virtual functions ... know which copy is being accessed and hence the error occurs Object Oriented Programming with C+ + / Session / 18 of 44 Virtual Base Classes (Contd.) s s To avoid two copies of the base class we...
- 44
- 540
- 1
Báo cáo khoa học: Characterization of testis-specific serine–threonine kinase 3 and its activation by phosphoinositide-dependent kinase-1-dependent signalling doc
... expression constructs encoding the full-length mouse HA-tagged TSSK3 (HA–mTSSK3), the following primer pair was used: primer ⁄ primer (GCGCTGTCGACCATGGAGGACTT TCTGCTCT ⁄ CATTGAATTCCTCAAGTGCTTGCTAGC CATG) ... full-length TSSK3 coding sequence was PCR amplified from a human or mouse testis cDNA, respectively, using oligonucleotide primers GGTGGTCATATGGAGG ACTTTCTRCTCT ⁄ CACTTGCCATTGCTTTTATCA and ligated into ... annealed oligonucleotides into pGEX)6P-1 vector cut with EcoRI, NotI Additionally, oligonucleotides contained KpnI restriction site to select for correct clones The pGEX)6P-1 constructs encoding GST-peptides...
- 14
- 374
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25