0

we have attempted to evaluate the existing literature pertaining to obesity and erectile dysfunction to determine whether a common pathophysiological link exists

Tài liệu Báo cáo khoa học: Mechanisms of obesity and related pathologies: Androgen deficiency and endothelial dysfunction may be the link between obesity and erectile dysfunction pptx

Tài liệu Báo cáo khoa học: Mechanisms of obesity and related pathologies: Androgen deficiency and endothelial dysfunction may be the link between obesity and erectile dysfunction pptx

Báo cáo khoa học

... erectile dysfunction remains poorly understood. In this minireview, we have attempted to eval-uate the existing literature pertaining to obesity and erectile dysfunction to determine whether a common ... flow-mediated dilation may have been a betterparameter to capture endothelial dysfunction. Employ-ing the latter approach together with ultrasonographywould have been a better clinical marker and ... discuss the relationships between obesity, endothelial dysfunc-tion and reduced plasma androgen levels (hypogona-dism), and link these pathological states to ED. Obesity is a major risk factor...
  • 13
  • 662
  • 0
Báo cáo y học:

Báo cáo y học: "An innovative method to evaluate the suture compliance in sealing the surgical wound lip"

Y khoa - Dược

... males and 5 females aged between 40 and 45 years), lipomas (n = 10; 5 males and 5 females aged between 40 and 45 years), and scar revision (n = 10; 5 males and 5 females aged between 40 and ... threads until the re-maining stain (if any) dried. Such photos were then analyzed to measure the surface stain area using an image analysis system (IAS). We chose the above tim-ing because we ... 10. Swanson NA, Tromovitch TA. Suture materials, 1980s: proper-ties, uses, and abuses. Int J Dermatol. 1982; 21: 373-378. 11. Langton JA and Gale TCE. Day-case anaesthesia. In: Aitkenhead AR,...
  • 7
  • 602
  • 0
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

Quản trị kinh doanh

... different meaning attached to it; a brand can be defined as a name, logo, symbol and identity or a trademark. Prasad and Dev. (2000) also states that a brand can be seen to include all tangible and ... 22Brand equity Aaker (1991) stated that brand equity can be referred to as a set of brand assets and liabilities linked to a brand, its name and symbol that add to or subtract from the value ... customer based-brand equity (brand image, brand loyalty and perceived quality) appears to have the least brand equity rating?• Does customer based-brand equity differ between the two restaurants...
  • 88
  • 986
  • 8
Tài liệu Analysing Commitments to Advance the Global Strategy for Women’s and Children’s Health pdf

Tài liệu Analysing Commitments to Advance the Global Strategy for Women’s and Children’s Health pdf

Sức khỏe trẻ em

... including Afghanistan, Haiti, Liberia, Pakistan, Sierra Leone, Southern Sudan, Tanzania and Uganda. The White Ribbon Alliance for Safe Motherhood, Family Care International, and International Budget ... in place a Governance and Accountability Action Plan. All grant-making foundations interviewed during the data-collection process have included a mandatory monitoring and evaluation framework ... health and human rights literacy and education, so that individuals and communities can have the information they need to make decisions about their health, claim their rights, and demand accountability....
  • 60
  • 666
  • 0
Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx

Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx

Báo cáo khoa học

... Dublin,Ireland). To generate the pEP7–HFE-N11 0A HA vector we used the following primer set: sense, ATGGAAAATCACGCCCACAGCAAGGAG; antisense, CTCCTTGTCGTGGGCGTGATTTTCCAT. To generate the pEP7–HFE-N13 0A HA ... mutagenesis. The HFE NN110/130AA mutant was made by introducing the N13 0A muta-tion into the pEP7–HFE-N11 0A HA plasmid. The HFENN130/234AA mutant was made by introducing the N23 4A mutation into the ... class I molecules and the protein is organizedinto a1 , a2 and a3 structural domains that resemblethose described for MHC class I and related proteins[4,16]. The N-terminal a1 and a2 domains...
  • 16
  • 538
  • 0
Resources to support the pilot of functional skills Teaching and learning functional English pot

Resources to support the pilot of functional skills Teaching and learning functional English pot

Kỹ năng viết tiếng Anh

... Learners can keep a talk diary for a week recording whom they have spoken to, for what reason and how they consciously adjusted their language and tone. Learners can plan and rehearse in their ... material that you have met before. We have written the material so that you can choose those parts that are most relevant to you. 1.4 How to read the standards The standards for functional ... happy or sad, from their expression and tone and the way they walk, stand or sit. • Tone of voice. Research has shown that the tone of voice carries more meaning than the individual words themselves....
  • 136
  • 489
  • 0
Arsenic transformations in the soil rhizosphere plant system fundamental and potential application to ph

Arsenic transformations in the soil rhizosphere plant system fundamental and potential application to ph

Môi trường

... ofAgrostis capillaris (Porter and Peterson, 1975) and H. lanatus (Meharg and Macnair, 199 1a) take up less As than non-tolerant plants. Meharg and Macnair (199 2a) showed that arsenate uptakein solution ... Deschampsia cespitosa and to a lesserextent as well for A. capillaris (Meharg and Macnair, 1991b). In contrast, no down regulationof arsenate/phosphate transporters was found forAs-tolerant Calluna ... ricecultivars followed the order DMAA B/AsVB/MMAAB/AsIII, while Carbonell-Barachina et al.(1998) obtained the order of DMAAB/MMAA$/AsVB/AsIIIfor two typical wetland plant speciesof the...
  • 20
  • 567
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Learning How to Conjugate the Romanian Verb. Rules for Regular and Partially Irregular Verbs" docx

Báo cáo khoa học

... ”s¸ca”;5. no alternation; a t˘aia” (to cut), ends in ”ia” and has a vowel before;6. no alternation; a speria” (to scare), ends in”ia” and has a consonant before;7. no alternation; a dansa” ... (263pp.).Ana-Maria Barbu. Romanian lexical databases:Inflected and syllabic forms dictionaries. InSixth International Language Resources and Evaluation (LREC’08), 2008.Angelo Roth Costanzo. Romance ... alternation:˘ a a for all the forms except the 1st and 2nd person plural; a tres˘alta” (to start, to take fright);15. alternation:˘ a a in the 3rd person singular and plural,˘ a e in the 2nd...
  • 5
  • 495
  • 0
On the Segregation of Genetically Modified, Conventional, and Organic Products in European Agriculture: A Multi-market Equilibrium Analysis doc

On the Segregation of Genetically Modified, Conventional, and Organic Products in European Agriculture: A Multi-market Equilibrium Analysis doc

Tự động hóa

... for the land constraint at the sector level and for the need for additionalresources to produce organic food. Model calibration and simulation allow insights into the qualitative and quantitative ... some parameters. The solution of the model—for baseline parameter valuesas well as other alternatives—allows us to determine the qualitative and quantitative economicimpacts of the possible large-scale ... specification is particularly useful here, because we can deduce the behaviour of the demand system from the value of a total elasticity that refers to aggregate food demand. To see this, define total...
  • 36
  • 573
  • 0
Báo cáo y học:

Báo cáo y học: "Use of the measure your medical outcome profile (MYMOP2) and W-BQ12 (Well-Being) outcomes measures to evaluate chiropractic treatment: an observational study"

Y học thưởng thức

... supervised the student chiropractors in the collection and analysis ofdata. MJW undertook a further overall statistical analysis of data and drafted the manuscript. All authors read and approved the ... profile(MYMOP2) and W-BQ12 (Well-Being) outcomesmeasures to evaluate chiropractic treatment:an observational studyBarbara I Polus†, Amanda J Kimpton†, Max J Walsh*†AbstractBackground: The objective ... of the MYMOP2questionnaire. The major strengths are considered as:patient-centred, applicable to any problem, quick and easy to complete and score, and very responsive to change. The main weakness...
  • 8
  • 538
  • 0
Báo cáo y học:

Báo cáo y học: "Users' guides to the medical literature: how to use an article about mortality in a humanitarian emergency"

Y học thưởng thức

... Finally,does the situation mandate humanitarian interventionbeyond the medical care and public health strategies cur-rently in place? The text below summarizes our approach to evaluating and ... related to violence, but rather to access and availability of health care, a lack of public healthinfrastructure and the emergence of malnutrition and seri-ous diseases or exposure. Without access ... Database Program (a database that contains information on armed conflicts of the world since 1989) [5], and the Database on the Human Impact of Complex Emergencies (CE-DAT) [6].Using the search...
  • 9
  • 694
  • 0

Xem thêm