villiers barbara c 1641 1709 countess of castlemaine duchess of cleveland and paramour
C++ Basics - More Flow of Control
... inner block and cannot be accessed outside the inner block The other variable exists only in the outer block and cannot be accessed in the inner block Copyright © 2007 Pearson Education, Inc Publishing ... the action of a branch is too simple to warrant a function call, use multiple statements between braces A block is a section of code enclosed by braces Variables declared within a block, are ... 37 switch-statement Syntax switch (controlling expression) { case Constant_1: statement_Sequence_1 break; case Constant_2: Statement_Sequence_2 break; case Constant_n: Statement_Sequence_n break;...
- 118
- 440
- 0
The Countess of Escarbagnas by Moliere
... muff and head-dress away in the cup in the closet, I mean COUN Call in that rascal of a page AND I say, Criquet! COUN Cease that "Criquet" of yours, stupid, and call out "Page." AND Page then, and ... the COUNTESS MR HARPIN, receiver of taxes, also in love with the COUNTESS MR BOBINET, tutor to the COUNT JEANNOT, servant to MR THIBAUDIER CRIQUET, servant to the COUNTESS THE COUNTESS OF ESCARBAGNAS ... and not Criquet, come and speak to missis I think he must be deaf Criq Page! page! SCENE VI. THE COUNTESS, JULIA, ANDRÉE, CRIQUET CRI What is it you want? COUN Where were you, you rascal? CRI In...
- 11
- 402
- 0
Tài liệu The Countess of Albany ppt
... usually accompany the eccentric feelings of such children as are subject to them Obstinate and taciturn, he tells us of the curious passion which he experienced for the little choristers, boys of twelve ... tales of the '45 and of the heroism of Prince Charlie And her mind, which, as afterwards appeared, was romantic, fascinated by eccentricity and genius, may easily have become enamoured of the ... gallant and chivalric young prince of whose irresistible manner and voice the canny chieftains had vainly bid each other beware when he landed with his handful of friends and called the Highlanders...
- 112
- 369
- 0
Tài liệu Department of Health and Human Services 200 Independence Avenue S.W., Washington, D.C. 20201 doc
... regulating the manufacture, marketing and distribution of tobacco products, protecting public health and reducing tobacco use by minors Accordingly, the Center for Tobacco Products was established ... 2010, CDC is building a cadre of health protection researchers, research training programs, and centers of excellence that enable multidisciplinary approaches to public health practice Performance ... patients, clinicians, and other decision-makers about what interventions are most effective for patients under specific circumstances TRANSPARENCY AND ACCOUNTABILITY Transparency: HHS Recovery Act funds...
- 114
- 610
- 0
Tài liệu Báo cáo khoa học: Binding of N- and C-terminal anti-prion protein antibodies generates distinct phenotypes of cellular prion proteins (PrPC) obtained from human, sheep, cattle and mouse doc
... were analyzed The percentages of the PrPC bands were calculated as arithmetic means and SE according to the antibody used for PrP detection Calculation of the banding patterns of 16 gels using antibody ... PrPC derived from cortex (c) , cerebellum (cb) and brain stem (bs) of sheep detected by antibodies SAF34 and SAF70, respectively (B) PrPC signals of cortex (c) , cerebellum (cb) and brain stem (bs) ... given for each antibody, and, accounting for differences among gel runs, SE values were calculated according to antibody used for PrP detection Calculation of the banding patterns of 17 gels using...
- 11
- 536
- 0
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
... presence of an excess of nonspeci c competitor calf thymus DNA mimicking randomsequence natural genetic material that can accommodate the cisplatin adducts regardless of the reactivity 4700 Fig Competition ... DNA comprises about 50% of 1,2-GG IACs, 25% of 1,2-AG IACs, 10% of 1,3-GNG IACs and interstrand crosslinks, and another 2–3% of monofunctional adducts It has been found that cisplatin cytotoxicity ... forms [33] Recently, it has been reported that accessibility of the p53 CTDBS is critical for (sequence-nonspeci c) cisPtDNA recognition [34] On the other hand, sequencespeci c binding of p53 to...
- 14
- 597
- 0
Tài liệu Báo cáo khoa học: Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation doc
... (1995) Cloning and characterization of a human protein kinase with homology to Ste20 J Biol Chem 270, 21695–21700 Creasy CL & Chernoff J (1995) Cloning and characterization of a member of the ... scaffold protein, connector enhancer of KSR1, CNK1, mediates the pro-apoptotic effects of a constitutively active Ras [15,25] Furthermore, Nore1 appears to direct recruitment of Mst1 to Ras complexes ... the C- terminal coiled-coil domains of Sav and Hpo were also crucial and ⁄ or sufficient for their interaction [19,21,23] These results indicate that the coiled-coil interaction between Mst and...
- 13
- 321
- 0
Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc
... abundance of heparin-like structures on the surface of the vascular bed, and the lack of good estimates of local concentrations of coagulation proteins or reactants during hemostatic reactions, ... Bottom right: molecular surface of FVa domains A1, A2, and A3 color-coded according to electrostatic potentials Preliminary docking of FVa Arg506 into the catalytic cleft of APC suggests that the ... FXa cofactor activity of the reaction intermediate, FVaint This facilitated the determination of loss of FVa cofactor activity during the initial stage of inactivation and minimized the influence...
- 13
- 654
- 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... forward and reverse primers, ATnI1F (5¢-CATATCACCATGGGTTCCCTTG-3¢) and ATnI292R (5¢-CTTGATTTGGATCCTTTAAGGTA TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ATnI130F (5¢-GCCAGAA CCATGGCGGAGGAAC-3¢) ... also cloned the cDNA encoding rabbit fast skeletal TnI from the back muscle of rabbit by RT-PCR using the primer set, RTnI1F (5¢-CAAACCTCACCATGGGAGAT GAAG-3¢) and RTnI181R (5¢-CCCCGGAGCCGGATCC CCAGCCCC-3¢) ... (5¢-GAGCATGGCGGGAT CCTACATGCGCAC-3¢) and RTnI96F (5¢-GCTGGAGG CCATGGACCAGAAGC-3¢) and RTnI181R, respectively (BamHI ⁄ NcoI sites and termination ⁄ initiation codons are indicated by underlines and bold...
- 12
- 514
- 0
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt
... 5¢-GGTTGCCAGCATCC AGAGTACTGGTGGCATCGTCC-3¢ and for TAP2 the complementary primers 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGC GTCCAGAGTACTGGTAGCCTCATCC-3¢ All primers were purchased ... complementary primers 5¢-GGATGAGGCTACCAGTGC TC TGGACGCCTAG TGCGAGCAGGC-3¢ and 5¢-GCCTGCTCGCACTAGG CGTCCAGAGCACTGGTAGCCTCATCC-3¢ All TAP constructs were transfected into T2 cells by electroporation using a ... 5¢-GGATGAGGCTACCAGTGCCCT GGATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATC CAGGGCACTGGTAGCCTCATCC-3¢ for 2V1 The resulting TAP constructs were cloned into the EcoRI site of pHbApr1neo [22] and sequenced fully...
- 16
- 407
- 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
... nuclear genome coded isoforms of CytOX V [10,32] The regulation of genes CytOX5a and CytOX5b, coding for the two isofoms Va and Vb, parallels that of genes CYC1 and CYC7, which encode iso-1 and ... iso-2 of yeast cytochrome c, respectively CytOX 5a and CYC1 are coexpressed under aerobic conditions (O2 > 0.5 lM), whereas CytOX 5b and CYC7 are co-expressed under hypoxic (O2 < 0.5 lM) and heme ... the catalytic activity of the enzyme by affecting its stability or composition Although succinylacetone and CoCl2 are known inhibitors of heme biosynthesis, these agents also elicit nonspeci c and...
- 9
- 554
- 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
... enhancing effect of TS on LPS/IFN-induced NO production is caused by enhancement of iNOS protein induction Effects of a-T and its derivatives on the enhancement by TS of LPS/IFN-induced NO production ... N., Mayne, G .C. , Olejnicka, B., Negre-Salvayre, A., Stı´ cha, M., Coffey, R.J & Weber, C (2001) Induction of cancer cell apoptosis by a-tocopheryl succinate: molecular pathways and structural requirements ... (Ro31-8220 and GF109203X) on the enhancement by TS of LPS/IFNinduced NO production in VSMC (A), and Western blot analysis of PKCa in control VSMC, VSMC treated with LPS/IFN and VSMC treated with TS and...
- 6
- 494
- 0
Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx
... Hoganson, C. W., Babcock, G.T & Ferguson-Miller, S (1999) Definition of the interaction domain for cytochrome c on cytochrome c oxidase I Biochemical, spectral, and kinetic characterization of surface ... domains by chemical modification J Biol Chem 253, 149–159 Rieder, R & Bosshard, H.R (1980) Comparison of the binding sites on cytochrome c for cytochrome c oxidase, cytochrome bc1 and cytochrome c1 J ... the docked complex by a complete, systematic search J Biol Chem 274, 38051–38060 Michel, B & Bosshard, H.R (1984) Spectroscopic analysis of the interaction beween cytochrome c and cytochrome c oxidase...
- 9
- 457
- 1
Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc
... (Varian Inc., Zug, Swizerland) Kinetic parameters were calculated using prism (GraphPad Software Inc., San Diego, CA, USA) Bioinformatics The molecular mass and theoretical extinction coefficient of ... importance of this accessory ‘caddie protein’ for copper incorporation into the Streptomyces tyrosinase [7,9] and the expression of active Streptomyces tyrosinase in either Escherichia coli or ... (2006) Crystallographic evidence that the dinuclear copper center of tyrosinase is flexible during catalysis J Biol Chem 281, 8981–8990 Klabunde T, Eicken C, Sacchettini JC & Krebs B (1998) Crystal...
- 13
- 778
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... late-endosome ⁄ vacuole Traf c 2, 622–630 Piper RC, Cooper AA, Yang H & Stevens TH (1995) VPS27 controls vacuolar and endocytic traf c through a prevacuolar compartment in Saccharomyces cerevisiae J Cell ... the conserved RDF sequence for assembly and activity can be overcome by addition of Vta1p and a second Vps4p molecule with an intact C- terminal helix We also find evidence for the co-evolution of...
- 23
- 490
- 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx
... the transactivation of growth hormone receptors and in the activation of MAPK cascades, as well as different localizations of the receptor constructs before and after activation may also contribute ... Faussner et al Role of helix and C- termini in bradykinin receptors Fig Schematic representation of the C- terminal B1wt and B2wt sequences and chimera thereof The C- terminal sequences beginning at ... intact cells Biol Chem 385, 835–843 21 Marchese A, Chen C, Kim YM & Benovic JL (2003) The ins and outs of G protein-coupled receptor trafficking Trends Biochem Sci 28, 369–376 22 Kalatskaya I, Schussler...
- 12
- 595
- 0
C++ Lab 15 Review of Arrays, Array of Objects and Vector Dr. John Abraham, Professor doc
... (shuffled[]) and place random numbers from to 52 in it Once we have the random numbers, we just display the card names in that order string cards[52]={ "CA", "C2 ", "C3 ", "C4 ", "C5 ", "C6 ", "C7 ", "C8 ", "C9 ", "C1 0","CJ","CQ","CK", ... data, the second one to find the difference of each score from the mean and the third one to find store the square of deviation of each score The mean is calculated by adding all valid scores stored ... Read scores from a file into an array Keep track of number of scores entered Find difference of each score from the Mean Square the differences and add the squares find stadard deviation create...
- 7
- 416
- 1
Báo cáo " Cell suspension culture Panax ginseng C. A. Meyer: Role of plant growth regulators and medium composition on biomass and ginsenoside production " docx
... tissue culture process in order to be economically competitive with field cultivation of ginseng A number of physical and chemical factors that could influence secondary metabolite in plant cell cultures ... of the hormone concentration and combination are often effective For ginseng cell growth, 2,4 D is most commomly used in routine culture maintenance [6] But use of this suspected carcinogen often ... established cell suspension culture of ginseng cell and some attempts have been made to increase biomass and ginsenoside yield of ginseng cell culture Materials and methods Stock cell culture and culture...
- 6
- 492
- 0
Báo cáo khoa học: Hydroperoxide reduction by thioredoxin-specific glutathione peroxidase isoenzymes of Arabidopsis thaliana potx
... ATGGCTGCAGAAAAAACCG ⁄ GGATCCTTTAAGCG GCAAGCAA), AtGPX2 (CATATGGCGGATGAATC TCCAA ⁄ GGATCCTCCTCCTCCTGGTGAT), AtGPX5 (CATATGGGTGCTTCATCATCAT ⁄ GGATCCCTGTG CGTGTTCACAA) and AtGPX6 (CATATGGCAGC AGAGAAGTCTG ⁄ ... AGAGAAGTCTG ⁄ GGATCCAGTTATCCAGATTGAA) without transit peptides or Trx h2 (CATATGGGA GGAGCTTTATC ⁄ GGATCCGCGTTAACAATGCTCA) and Trx h3 (CATATGGAAGAGAAGCCGCA ⁄ GGATCC AAATCAAGCAGCAGC) proteins were ... Journal compilation ª 2006 FEBS A Iqbal et al several other plants, such as tomato, sunflower and Chinese cabbage, and microorganisms such as Synechocystis PCC 6803, Saccharomyces cerevisiae and Plasmodium...
- 9
- 414
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008