using an indexer exposed by a class
Báo cáo khoa học: "An Automatic Method for Summary Evaluation Using Multiple Evaluation Results by a Manual Method" pptx
Ngày tải lên :
17/03/2014, 04:20
... 419–426 Kenji Yasuda, Fumiaki Sugaya, Toshiyuki Takezawa, Seiichi Yamamoto and Masuzo Yanagida 2003 Applications of Automatic Evaluation Methods to Measuring a Capability of Speech Translation System ... 10 summaries in a dataset were selected, and ranked by Yasuda’s method Then, Yasuda’s method was evaluated using Precision Two summaries were also ranked by ROUGE and by cosine distance and both ... and asked them to translate 23 Japanese conversations into English They also generated translations using a system for each conversation Then, they evaluated both translations using an automatic...
- 8
- 359
- 0
Tài liệu Báo cáo khoa học: "Using an Annotated Corpus as a Stochastic Grammar" ppt
Ngày tải lên :
22/02/2014, 10:20
... Newark P Resnik, 1992 "Probabilistic Tree-Adjoining Grammar as a Framework for Statistical Natural Language Processing", Proceedings COLING92, Nantes R Scha, 1990 "Language Theory and Language ... America~ English" DARPA Speech and Naawal Language Workshop, ~ Grove, Morgan Kaufmarm F Pereira and Y Schabes, 1992 "Inside-Outside Reestimation from Partially Bracketed Corlmra', ProceedingsACY.,92, ... that DOP can be parsed in polynomial time by using Monte Carlo techniques An important advantage of using a corpus for probability calculation, is that no tr0jning of parameters is needed, as...
- 8
- 393
- 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt
Ngày tải lên :
11/08/2014, 00:23
... Journal of Obstetrics and Gynaecology, which has substantiated information about ovarian cancers and amenorrhea [8] In this way, continually organizing and updating information on an Ishikawa diagram ... relevant information In short, an Ishikawa diagram can assist memory and the retrieval of relevant medical case reports and literatures Acknowledgements I would like to thank the Journal of Medical ... diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching medical students and...
- 3
- 381
- 0
Báo cáo y học: "The effectiveness of hand-disinfection by a flow water system using electrolytic products of sodium chloride, compared with a conventional method using alcoholic solution in an" ppt
Ngày tải lên :
12/08/2014, 18:20
... Hospital, Yamadaoka, Suita, Osaka 565, Japan 2Research Institute for Microbial Diseases, Osaka University, Yamadaoka, Suita, Osaka 565, Japan Published: 22 May 1998 References Doebbeling BN, Stanely ... Each value was analysed using Mann-Whitney (between two groups) or anlaysis of variance (ANOVA; among three groups) tests Statistical significance was considered at P < 0.05 The number of bacteria ... et al Critical Care 1998, 2:79 http://ccforum.com number of bacteria after hand-washing/the number of bacteria before hand-washing)] Values are calculated from raw data and expressed as mean...
- 2
- 450
- 0
seafood processing wastewater treatment by using an activated sludge reactor followed by a cyperusmalaccensis lam. constructed wetland
Ngày tải lên :
09/01/2015, 08:53
... bamboo (Dracaena sanderiana Hort.) two plants had advantage character are showed in figure 2-3 (a) (b) Figure 2-3 Two species of Limnophila (b) and Cyperus (a) genera Biomass of two plants are ... et al., 2008)), - Trained maintenance staff or committed users are available who carry out the (simple) maintenance tasks, - Wastewater not too toxic for bacteria and plants, - Adequate quantities ... support and attachment surface for microorganisms able to anaerobically (and/or anoxically if nitrate is present) reduce the organic pollutants into CO2, CH3, H2S, etc Phosphorus is adsorbed and can...
- 61
- 420
- 0
Tissue engineering of an osteochondral transplant by using a cell scaffold construct
Ngày tải lên :
14/09/2015, 14:07
... in preparation Ho STB, Hutmacher DW, Ekaputra AK, Hitendra KD and Hui JH The evaluation of a biphasic osteochondral implant coupled with an electrospun membrane in a large animal model Manuscript ... by the organic matrix and high water content These fundamental compositional differences result in different mechanical behaviors Trabecular bone is stiffer than cartilage and it has an instantaneous ... Tomography (CT) and Magnetic Resonance Imaging (MRI) are used as a digital input for RP design and fabrication [56] Similarly RP scaffolds can be customized to fit an implantation site and this advantage...
- 218
- 441
- 0
Five Steps to Using Your Textbook to Build a More Dynamic EFL Conversation Class
Ngày tải lên :
06/09/2013, 11:10
... be 10 pairs Students then pair off and sit facing each other By randomly assigning students to a new partner every lesson, the class is more dynamic and perhaps more significantly, after a few ... usually this by having each student choose from a stack of cards labeled 1A, 2A, 3A etc and 1B, 2B, 3B etc Thus, if a student's card reads 1A his or her partner is the 1B cardholder If there are ... oral presentations or computer lab days These types of extra activities can be integrated within the week-to-week class curriculum and provide an additional motivational source from the usual...
- 3
- 500
- 0
How to write an effective biz plan a step by step guide
Ngày tải lên :
10/12/2013, 09:08
... bại doanh nghiệp d a theo kế hoạch kinh doanh thấp nhiều so với doanh nghiệp kế hoạch kinh doanh Khái niệm kế hoạch kinh doanh ? Kế hoạch kinh doanh mô tả trình kinh doanh bạn khoảng thời gian Nó ... nghệ châu (AITCV), Hà nội hợp tác với SEAQIP Vietnam tổ chức www.planware.org, Viết kế hoạch kinh doanh, 2001 Practical Business Planning for newventure Kế hoạch kinh doanh tài liệu tham khảo DIRECTION ... _ _ _ uảng cáo qua phơng tiện đại chúng (nêu cụ thể): Q Báo/Cẩm nang mua sắm/ Tập san thơng mại/ Trang Vàng/ Danh bạ ngành/Catalog/ đặt hàng qua th/Đài phát thanh/Tuyền hình/Bảng dán yết...
- 96
- 614
- 0
Tài liệu Defining and Using a Class pdf
Ngày tải lên :
15/12/2013, 00:15
... just as you can create many int variables in a program Each instance of the Circle class is an object that occupies its own space in memory, and runs independently of all the other instances ... type An object is an instance of that type, created when the program runs For example, it is possible to create many instances of the Circle class in a program by using the new keyword, just as ... accept that the new keyword creates a new instance of a class (more commonly called an object) IMPORTANT Don't get confused between the terms class and object A class is the definition of a...
- 2
- 434
- 0
Tài liệu Creating a Class That Participates in an Automatic Transaction ppt
Ngày tải lên :
24/12/2013, 05:15
... in an existing transaction, to start a new transaction, or to not participate in a transaction The following steps prepare a class to participate in an automatic transaction: Derive the class ... transactions that span multiple remote databases and multiple resource managers Objects participating in automatic transactions not need to anticipate how they might be used within a transaction ... automatic transaction Once an object is marked to participate in a transaction, it will automatically execute within a transaction The object's transactional behavior is controlled by the value...
- 5
- 410
- 0
Tài liệu Filling a DataSet Using an XML Template Query ppt
Ngày tải lên :
21/01/2014, 11:20
... identified by the tag with the name attribute used to specify the parameter name and the parameter default value optionally specified between the and tags Parameter ... object The parameter is created using the CreateParameter( ) method of the SqlXmlCommand class SqlXmlAdapter Links the SQLXML managed classes to the disconnected ADO.NET DataSet class A description ... SQLXML Managed Classes consist of three classes: SqlXmlCommand Represents a command to execute against the SQL Server database SqlXmlParameter Stores parameters used by the SqlXmlCommand object...
- 8
- 356
- 0
Tài liệu Implementing an Enumerator by Using an Iterator pptx
Ngày tải lên :
21/01/2014, 15:20
... slithy, the, and, brillig, Twas Defining an Enumerator for the Tree Class by Using an Iterator In the next exercise, you will implement the enumerator for the Tree class by using an iterator Unlike ... the data in the tree to be preprocessed into a queue by the MoveNext method, you can define an iterator that traverses the tree by using the more natural recursive mechanism, similar to the WalkTree ... order: Twas, brillig, and, the, slithy, toves If you want to provide alternative iteration mechanisms presenting the data in a different sequence, you can implement additional properties that implement...
- 5
- 328
- 0
Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx
Ngày tải lên :
17/02/2014, 14:20
... Chapter Problem 1-19 Evaluate each of the following to three significant figures and express each answer in SI units using an appropriate prefix: (a) a 1/b1, (b) a2 b2/c2, (c) a3 b3 Units Used: μm ... resultant force is to be F1, directed along the keel aa as shown, determine the magnitudes of forces T and P acting in each rope and the angle θ of P so that the magnitude of P is a minimum T acts ... Upper Saddle River, NJ All rights reserved This material is protected under all copyright laws as they currently exist No portion of this material may be reproduced, in any form or by any means,...
- 1.1K
- 1.1K
- 2
Tài liệu Báo cáo khoa học: Guanidinium chloride- and urea-induced unfolding of FprA, a mycobacterium NADPH-ferredoxin reductase Stabilization of an apo-protein by GdmCl docx
Ngày tải lên :
19/02/2014, 16:20
... the FprA and the 0.8 m CaCl2-stabilized apo-protein and analysed it by monitoring the changes in tryptophan fluorescence as summarized in Fig 4A For 0.8 m CaCl2-stabilized FprA, a sigmoidal dependence ... unfolding A Trp Emm Max (nm) temperature For native FprA, a broad sigmoidal transition between 30 and 65 °C having an apparent Tm (mid point of thermal denaturation) of 49 °C and a loss of ... of increasing concentrations of GdmCl In (A) circles and squares represent data for native and 0.2 M CaCl2-stabilized FprA, respectively changes in enzymatic activity, FAD and tryptophan fluorescence...
- 9
- 436
- 0
Tài liệu Báo cáo khoa học: "Using Multiple Sources to Construct a Sentiment Sensitive Thesaurus for Cross-Domain Sentiment Classification" doc
Ngày tải lên :
20/02/2014, 04:20
... techniques In EMNLP 2002, pages 79– 86 Patrick Pantel and Deepak Ravichandran 2004 Automatically labeling semantic classes In NAACLHLT’04, pages 321 – 328 Sunita Sarawagi and Alok Kirpal 2004 Efficient ... Pan, Xiaochuan Ni, Jian-Tao Sun, Qiang Yang, and Zheng Chen 2010 Cross-domain sentiment classification via spectral feature alignment In WWW 2010 Bo Pang and Lillian Lee 2008 Opinion mining and ... sentiment analysis Foundations and Trends in Information Retrieval, 2(1-2):1–135 Bo Pang, Lillian Lee, and Shivakumar Vaithyanathan 2002 Thumbs up? sentiment classification using machine learning...
- 10
- 555
- 0
Báo cáo khoa học: "A Flexible POS Tagger Using an Automatically Acquired Language Model" potx
Ngày tải lên :
08/03/2014, 21:20
... Kaufmann Richards, D Landgrebe and P Swain 1981 On the accuracy of pixel relaxation labelling IEEE Transactions on System, Man and Cybernetics Vol SMC-11 C Samuelsson, P Tapanainen and A Voutilainen ... constraints All this makes that the performance cannot reach 100%, and that an accurate analysis of the noise in WS3 corpus should be performed to estimate the actual upper bound that a tagger can ... 1989) for a summary Its most remarkable feature is that it can deal with any kind of constraints, thus the model can be improved by adding any constraints available and it makes the tagging algorithm...
- 8
- 283
- 0
SCAFFOLDING AN EFL (ENGLISH AS A FOREIGN LANGUAGE) ''''EFFECTIVE WRITING'''' CLASS IN A HYBRID LEARNING COMMUNITY pot
Ngày tải lên :
19/03/2014, 07:20
... planning and use fewer words They are less accurate and less effective in stating their goals and organising material There are also differences in using appropriate grammatical and rhetorical ... Learning Management Systems are used in the English Department, namely: TappedIn ® and MOODLE ® Each has its own advantages and disadvantages TappedIn ® is simpler to operate than MOODLE ® because ... gratitude to Professor Kar-Tin Lee and Associate Professor Rod Nason for their encouragement, patience and invaluable guidance Their kind, constant and thoughtful assistance meant a great deal...
- 245
- 1.2K
- 2
Báo cáo khoa học: "Learning a Compositional Semantic Parser using an Existing Syntactic Parser" pot
Ngày tải lên :
23/03/2014, 16:21
... Mooney 2005 A statistical semantic parser that integrates syntax and semantics In Proc of 9th Conf on Computational Natural Language Learning (CoNLL-2005), pages 9–16 Ruifang Ge and Raymond J Mooney ... 2006 Learning for semantic parsing with statistical machine translation In Proc of Human Language Technology Conf / N American Chapter of the Association for Computational Linguistics Annual Meeting ... in-domain data (Syn0, 82.15% for CL ANG and 76.44% for G EOQUERY) available): S CISSOR (Ge and Mooney, 2005), an integrated syntactic-semantic parser; K RISP (Kate and Mooney, 2006), an SVM-based parser...
- 9
- 277
- 0
Báo cáo khoa học: Creating hybrid proteins by insertion of exogenous peptides into permissive sites of a class A b-lactamase doc
Ngày tải lên :
30/03/2014, 02:20
... all class A b-lactamases, TEM-1 folds into a structure formed by an a ⁄ b-domain and an all -a- domain (Fig 1A) At the junction between the two domains, a groove harboring the active site is partially ... C, Frere JM & Waley SG (1987) Automated analysis of enzyme inactivation phenomena Application to beta-lactamases and DD-peptidases Biochem Pharmacol 36, 2393–2403 23 Giannella RA (1976) Suckling ... BS, Margulies DH et al (1995) Molecular analysis of the same HIV peptide functionally binding to both a class I and a class II MHC molecule J Immunol 154, 1973–1986 Gariepy J, Lane A, Frayman F,...
- 11
- 358
- 0
Báo cáo khoa học: De novo RNA synthesis by a recombinant classical swine fever virus RNA-dependent RNA polymerase pot
Ngày tải lên :
30/03/2014, 20:20
... TTATACGAGGTTAGTTCATTC ATATACGAGGTTAGTTCATTC TAATACGACTCACTATAGGGTGCCATGAA CAG GTGCCATGAACAGCAGAGATTTTTATAC TAGCCATGCCCATAGTAGG ATCAGGTCGTACTCCCATCAC TAATACGACTCACTATAGCGCGGGTAAC GCGCGGGTAACCCGGGATCTGAA ... CATGCCATGGGCAGTAATTGGGTGATGCA GAAGATCTTAATGATGATGATGATGATG GCTGCCATTGTACCTGTCTGCCCCTT ATCAGGAGACCAGCAGCCCCGCACACAT ATGTGTGCGGGGCTGCTGGTCTCCTGAT GTATACGAGGTTAGTTCATTC CTATACGAGGTTAGTTCATTC TTATACGAGGTTAGTTCATTC ... performed using a primer complementary to the newly synthesized minus-strand (lanes and 3) or plus-strand RNA (lanes and 5), followed by PCR amplification Lane 1, 100 bp DNA ladder; lanes and 4, RNA template...
- 10
- 471
- 0