using a repository revision number in a package version
Báo cáo hóa học: " A validation study using a modified version of Postural Assessment Scale for Stroke Patients: Postural Stroke Study in Gothenburg (POSTGOT)" doc
... SwePASS in the acute stage Page of after stroke, both in clinical and research settings In addition, the SwePASS was easy to apply and fast to administer in clinic Additional material Additional file ... PASS validation should be performed with a statistical analysis aimed for calculations of non-parametric data, besides traditional statistical methods As far as we know, newer statistical analysis ... SwePASS in the intrarater study The rs were high (in line with adopting Table Participant characteristics for the study populations in the two reliability investigations Intrarater Interrater...
- 8
- 408
- 0
Báo cáo khoa hoc:" A validation study using a modified version of Postural Assessment Scale for Stroke Patients: Postural Stroke Study in Gothenburg (POSTGOT)" ppt
... SwePASS in the acute stage Page of after stroke, both in clinical and research settings In addition, the SwePASS was easy to apply and fast to administer in clinic Additional material Additional file ... PASS validation should be performed with a statistical analysis aimed for calculations of non-parametric data, besides traditional statistical methods As far as we know, newer statistical analysis ... SwePASS in the intrarater study The rs were high (in line with adopting Table Participant characteristics for the study populations in the two reliability investigations Intrarater Interrater...
- 8
- 298
- 0
Natural botanical products have a long history in the world and are featured in using a complex
... on ultrasound-guided intratumoral injection of "Star-99" in treatment of hepatocellular carcinoma of nude mice World J Gastroenterol 2003, 9: 701-5 Nandakumar KS, Lakshmi Rao K, Pardhasaradhi BV, ... ulcer and inflammatory bowel diseases and pathogenesis of experimental ulcers, inflammation and cancer in the gastrointestinal tract Prof Cho has published more than 250 research peerreviewed papers, ... the Gastrointestinal Pharmacology Section of International Union of Pharmacology He serves on the editorial board of several journals such as European Journal of Pharmacology, Journal of Gastroenterology...
- 9
- 712
- 0
Estimation of Proper Strain Rate in the CRSC Test Using a Artificial Neural Networks
... gathering the data for use in training and testing the neural network A large training data reduces the risk of under-sampling the nonlinear function, but increases the training time To improve training, ... consolidation SELECTION OF STRAIN RATE r= V − Vmin Vmax − Vmin Data Collection Data Normalization Parametric Studies (3) Training and Testing ANN in which LI is the liquidity index with soil saturated, ... steps using a load increment ratio of 1.0 which was maintained for 24 hours The CRSC tests were carried out after confirming full saturation using B value, and were performed with the strain rate...
- 5
- 516
- 1
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
... a wind farm of HAWT using GA gives a uniform grid arrangement similar that obtained by Grady et al [2]; this is different than that obtained by Mosetti [1] who obtained a somewhat random arrangement ... of Engineering in department of Mechanical Engineering and Materials Science at Washington University in St Louis, MO, USA He is a Fellow of ASME, AIAA, IEEE, and SAE E-mail address: rka@wustl.edu ... University in St Louis He received B.S in Mechanical Engineering from Shanghai Jiao Tong University in China in 2008 and M.S in Mechanical Engineering from Washington University in St Louis in 2010 Xiaomin's...
- 12
- 635
- 1
Using a DataReader Object in Visual Studio .NET
... SqlDataReader object to a string Also notice you include the namespace when referencing the SqlDataReader class: you use System.Data.SqlClient SqlDataReader when creating the SqlDataReader object ... System.Data.SqlClient.SqlDataReader mySqlDataReader = sqlCommand1.ExecuteReader(); while (mySqlDataReader.Read()) { listView1.Items.Add(mySqlDataReader["CustomerID"].ToString()); listView1.Items.Add(mySqlDataReader["CompanyName"].ToString()); ... ConnectionString property is set to: data source=localhost;initial catalog=Northwind;persist security info=False;user id=sa;pwd=sa;workstation id=JMPRICE-DT1;packet size=4096 Notice the substring pwd=sa in...
- 4
- 535
- 0
Tài liệu Using a DataView to Control Edits, Deletions, or Additions in Windows Forms pdf
... adding, editing, or deleting the data in the control Binding a DataGrid to a DataTable binds to the default view of the underlying DataTable The DataView class represents a view of the DataTable ... or sets a Boolean value indicating whether deletes are allowed AllowEdit Gets or sets a Boolean value indicating whether edits are allowed AllowNew Gets or sets a Boolean value indicating whether ... SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable dtOrders = new DataTable("Orders"); da.FillSchema(dtOrders, SchemaType.Source);...
- 3
- 532
- 0
Tài liệu Using XPath to Query Data in a DataSet doc
... ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable orderTable = new DataTable(ORDERS_TABLE); da.Fill(orderTable); ds.Tables.Add(orderTable); // Fill the OrderDetails table and add it to the DataSet da = new SqlDataAdapter("SELECT ... [Order Details]", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); da.Fill(orderDetailTable); ds.Tables.Add(orderDetailTable); ... = new DataSet("Orders_OrderDetails"); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]);...
- 4
- 442
- 0
Tài liệu Báo cáo khoa học: "Word Order in German: A Formal Dependency Grammar Using a Topological Hierarchy" pptx
... our findings are presented, without recourse to any mathematical formalism, in the usual terminology of traditional German grammars In Section 3, a mathematical formalism is proposed to state ... field can be occupied by a non-verbal phrase or by a verb creating an embedded domain Formalization A grammar in the formalism we introduce in the following will be called a Topological Dependency ... creation rules Creation of the main domain in the initial field: (Vfin, i, md, [) Creation of an embedded domain in a major field: (V¬fin, f, ed, ]) Creation of a verbal cluster in the right bracket...
- 8
- 575
- 0
Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx
... Sentence Reptuentatton in Natural Language Inferenctng', to appear in IJCAI Proceedinqs 79 13 [KAMAN79] Kaplan, S J , "Cooperative Responses from a Portable Natural Larquage Data Base Query System', ... i dominates wh Affix-hopping follows subject-aux inversion In the Paraphraser it is a combination of what is commonly thought of as afflx-hopplng and number- agreement Tense and number are attributes ... r Academia, Prague, ~ ~ [FIRBAS R6] Firhas, Jan, "On Defining the Theme in Functional Sentence Analysis", Travaux Lin~uistigues de Prague i, Univ of Alabama P r e s ~ [FIRBAS 74] Firbas,Jan,...
- 6
- 532
- 0
Tài liệu Báo cáo khoa học: "Choosing the Word Most Typical in Context Using a Lexical Co-occurrence Network" ppt
... disambiguation using statistical models of Roget's categories trained on large corpora In Proceedings of the14th lnternational Conference on Computational Linguistics (COLING-92), pages 4~ a a.50 ... turn instead to a less ideal source: the authors of the Wall Street Journal The problem is, of course, that authors aren't always typical A particular word might occur in a 'pattern' in which another ... Stanford, CA, March Elhadad, Michael 1992 Using Argumentation to Control Lexical Choice: A Functional Unification Implementation Ph.D thesis, Columbia University Golding, Andrew R and Yves Schabes...
- 3
- 345
- 0
Studying Aesthetics in Photographic Images Using a Computational Approach pot
... aesthetics and originality ratings for a given image A plot of 3581 unique photograph ratings can be seen in Fig As can be seen, aesthetics and originality ratings have approximately linear correlation ... subjective, and there are no agreed standards for rating This may render absolute scores less meaningful Again, ratings above or below certain thresholds on an average by a set of unique users generally ... Overall Accuracy Class Low accuracy Class High accuracy 78 76 90 Accuracy (in percentage) Accuracy (in percentage) 95 85 80 75 70 74 Overall Accuracy Class Low accuracy Class High accuracy 72 70...
- 14
- 440
- 0
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx
... neutral red, and fixed with 1% formaldehyde containing 1% CaCl2 for The dye incorporated into viable cells was extracted with 50% ethanol containing 1% acetic acid, and absorbance at 540 nm was measured ... disorders including Alzheimer’s, polyglutamine and Parkinson’s disease are though to be caused by an accumulation of protein aggregates in the brain [24], and Hsps such as Hsp70 and Hsp40 are shown ... Ishihara, K., Yasuda, K & Hatayama, T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, Hsp105 Biochim Biophys Acta 1444, 138–142 16 Yasuda, K., Nakai, A. ,...
- 8
- 470
- 0
Stream Prediction Using A Generative Model Based On Frequent Episodes In Event Sequences doc
... engine could offer users a new interface a ordance (e.g., sort search results based on different meta-data), or search paradigm (e.g., engage in an instant messaging conversation with a domain ... requiring only one automaton per candidate episode All automata are initialized at the start of every sequence, Xi ∈ DY , and the automata make transitions whenever suitable events appear as we ... Y) An outline of the training phase is given in Algorithm The algorithm is assumed to have access to some historical (or training) data in the form of a long event stream, say sH To build a prediction...
- 9
- 497
- 0
Monetary Policy in the Eurozone: Evaluating the European Central Bank’s interest rate decisions and the needs of member states using a Taylor rule ppt
... country has a number of implications Martin Feldstein argues, with claims based on 1999 data, that “monetary policy that was too expansionary for Spain and Ireland, causing a substantial acceleration ... Bergsten and Kirkegaard 2012 Shambaugh 75 Shambaugh 76 Shambaugh 77 Shambaugh 11 78 Shambaugh 17 79 Shambaugh 13 80 Shambaugh 17 81 Shambaugh 29 74 Srivangipuram 28 As these crisis are in some way linked ... the euro area periphery and even larger intra-euroarea current account imbalances A banking crisis was first evident in Ireland but is not spreading 68 Gerlach Lopez and Papell 70 Kirkegaard 2011...
- 41
- 513
- 0
Báo cáo khoa học: Analysis of the CK2-dependent phosphorylation of serine 13 in Cdc37 using a phospho-specific antibody and phospho-affinity gel electrophoresis doc
... Nishida E, Kadowaki T, Matsuzaki F, Iida K, Harada F, Kasuga M, Sakai H & Yahara I (1986) Two mammalian heat shock proteins, HSP90 and HSP100, are actin-binding proteins Proc Natl Acad Sci USA 83, ... binding an activating regulatory coprotein to an inactive catalytic subunit can activate a kinase In many signal-transducing protein kinases, site-specific phosphorylation by an upstream protein ... unphosphorylated proteins in SDS ⁄ PAGE [5] Protein kinase activity in cells is regulated in many different ways Releasing an inhibitory subunit from a catalytic subunit can activate a kinase By contrast,...
- 14
- 342
- 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi ... Nishioka C, Furihata M, Koeffler HP, Yokoyama A: Analysis of Aurora B kinase in non-Hodgkin lymphoma Lab Invest 2009, 89:1364-1373 Ikezoe T, Yang J, Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, ... Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, et al: AZD1152, a novel and selective aurora B kinase inhibitor, induces growth arrest, apoptosis, and...
- 10
- 618
- 0
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx
... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...
- 10
- 541
- 0
Báo cáo hóa học: " Quantification of the effects of an alpha-2 adrenergic agonist on reflex properties in spinal cord injury using a system identification technique" pptx
... referred the patients and participated in interpreting data, and WZR participated in interpreting data and writing the manuscript All authors read and approved the final manuscript Acknowledgements ... because of their time constraints, and their data are not included here Patients had sustained a traumatic, motor incomplete non-progressive spinal cord injury, with an American Spinal Injury Association ... 28 Mathias CJ, Luckitt J, Desai P, Baker H, el Masri W, Frankel HL: Pharmacodynamics and pharmacokinetics of the oral antispastic agent tizanidine in patients with spinal cord injury J Rehabil...
- 7
- 465
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25