... negative impacts, especially in the future, when the province has the plan to develop the aquaculture to be the key sector of local economics [6]. A re a (h e c ta r s ) January and ... environment [3]. One of the disadvantages is that the relative importance of evaluation criteria is determined without considering the scales on which the criteria are measured. Another disadvantage is the large amount of ... their living; they need to maintain their families. Also because of the relative large initial investment costs they are in debt and have to repay the banks in short terms. The ...
... the foreign language Other reason is because of motivation lack to practice the second language in daily conversation They are also too shy and afraid to take part in the conversation Many factors ... motivation in language learning There are many factors that affect students’ motivation such as the teacher – related factors, student – related factors, materials, test and so on Oxford and Shearin ... taught in almost schools in Vietnam In respond to an appeal from social to improve the quality of education toward regional and international standards, language institutions are marking great...
... of the manipulator torch tip on the x-y plane tothe center C of platform, φ w is the heading angle in the horizontal plane of the welding torch, and φ C is the heading angle of the mobile platform ... on, and the manipulator has the duty of reaching tothe altitude of the welding point 2.2 Kinematic Modeling for the Mobile Platform The kinematic equation of the platform can be described as the ... with respect tothe tangent line of the welding trajectory at the welding point The rotation of the last link assures that the orientation of torch has a right gesture at the certain Trang TẠP CHÍ...
... the result of adaptation between each species is calculated as a proxy for functional divergence relative tothe underlying mutation rate One can then search for differences in the average value ... developmental divergence and conservation along branches leading to evolutionarily derived life histories can provide a deeper understanding of the role that adaptation has in shaping development Another ... genome-scale analyses [3-7] are beginning to provide insights into the action of selection across development, the approach faces several challenges One is that expression levels of many regulatory genes...
... median) and factor loadings related to organizational characteristics and culture towards research, measurement and evidence-based practice Factor analysis of the nine items produced a three-factor ... mean Factor analysis produced a 3-factor solution explaining 72% of the variance The final question re: organizational resistance to change was a noisy item with an unexplained variance of 82% and ... Columbia, Canada Department of Physical Therapy, University of Alberta, Edmonton, Alberta, Canada 8School of Physical Therapy, The University of Western Ontario, London, Ontario, Canada Authors’...
... Sasaki S, Adra CN, Kitaichi M, Inoue H, Yamauchi K, Tomichi N, Kurimoto F, Hamasaki N, Hopkin JM, Izuhara K, Shirakawa T, Deichmann KA: Genetic variants of IL-13 signalling and human asthma and ... There is now an extensive and growing list of candidate genes investigated with regard to traits associated with asthma and atopy The most investigated candidate location for atopy and asthma ... (see Table 1); these databases are constantly updated and are growing rapidly However, the data contained in them are far from infallible and as yet there has been no systematic review of the accuracy...
... describe the two main characters: Della and Jim After that, the teacher gives each group a role-play situation and asks them to roleplay conversations between the characters according tothe table ... in the story rather in the language Role-playing: The students play the roles of some characters in the story, action out some scene in the story as assigned by the teacher The dialogues can ... learning to speak The desire to communicate with others, often face -to- face and in real time, drives them to attempt to speak fluently and correctly Many people equate being able to speak a language...
... enables them to differentiate a brand from another 2.3.4 Brand loyalty According to Aaker (1991, p39), brand loyalty is the attachment that a customer has toa brand” Yoo and Donthun (2001) also ... can be generalize to all customer of McDonald and Max hamburger because the sample is small to represent all the actual customer of both restaurant and also the fact that the students lived together ... competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand commonly provide the...
... language items (grammar and vocabulary) and consolidating language chances My knowledge background has been broaden thank to authentic materials 10 Post- reading activities help me to understand ... adults - Ask Ss to read the text - Ask Ss to tell what may cause Hepatitis and if it is more dangerous in children than in adults according tothe text - Ask Ss to read the text again and answer ... Read the passage, and for each question, choose one best answer based on what is stated in the passage or on what can be inferred by circling A, B, C, or D Another critical factor that plays a...
... in accuracy phase, not fluency phase I.2 Overview of language games I.2.1 What are language games? Language games can be used in language classes So what are games and what are language games? ... team (photo 2), the Italian national football team (photo 3) and the German national football team (photo 4) Then the teacher divides the class into groups namely: The English team’s fans, the French ... of the lesson once the target language has been introduced and explained They serve both as a memory aid and repetition drill and as a chance to use language freely, as a means to an end rather...
... deploy and manage software that is in the Windows Installer package file format The most important advantage of using software installation and maintenance technology is that you can manage and ... Enable users to run the New Task wizardto schedule an in-house tool to perform maintenance tasks on the order database Tasks Detailed steps Create a GPO for the Telemarketing organizational ... give administrators one major advantage: it combines the Windows Installer package files with the software installation and maintenance technology, so that administrators can easily deploy and manage...
... adding, editing, or deleting the data in the control Binding a DataGrid toa DataTable binds tothe default view of the underlying DataTable The DataView class represents a view of the DataTable ... SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable dtOrders = new DataTable("Orders"); da.FillSchema(dtOrders, SchemaType.Source); ... sets a Boolean value indicating whether deletes are allowed AllowEdit Gets or sets a Boolean value indicating whether edits are allowed AllowNew Gets or sets a Boolean value indicating whether...
... games 2.4.1 What are language games? Language games can be used in language classes So what are games and what are language games? First of all, what are games? Games are forms of entertainment derived ... receive information Normally, they are only asked to practice (role- play) and dramatize a dialogue or to talk about what they have to learn from a prose based on the previous answers at the end of ... Teaching a second language used to be aimed at enabling learners to read and appreciate class of literature Therefore, any teacher who was able to reach this aim was thought to be a good teacher...
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, ... at the TP901-1 phage attachment site PCR products upstream to pyk using primer pyk1 (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to...
... scenario, the activation of growth factor receptors may in turn activate the Ras ⁄ Rac1 pathway, which has been shown to play a critical role in HSF1 activation and HSP up-regulation [14] We have reported ... [13] The overexpression of a desaturase gene in Saccharomyces cerevisiae, or the addition of exogenous fatty acids, can change the unsaturated ⁄ saturated fatty acid ratio and exert a significant ... Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a key mediator of both mitogenic and stress signaling pathways,...
... members of the same equivalence class The equivalence classes will depend on the target language at hand For instance, in German, a and a will be assigned tothe same equiva¨ lence class, because some ... ¦ We trained three basic dictionaries using part of the Hansard data, around five megabytes of data (around 20k sentence pairs and 850k words) The basic dictionaries were built usingthe algorithm ... links: each word in the source language is paired with each word in the target language Then for each word pair the score is looked up in the dictionary, and the pairs are ranked from highest to lowest...
... 2002, meaning they lack the means to ensure themselves of healthy meals and are vulnerable to at least a mild form of chronic malnutrition.3 WEALTH AND VALUES I live in a home that has heat and running ... excited to read the Financial Times,” she says with a laugh When she was 14, her parents started a restaurant, and she began waitressing at night Her father encouraged her to save up for substantial ... So that weekend I went to Saks locally and told them that I was in New York, had bought all this makeup, came home, and my husband had a fit They took it all back That’s so me—there was no way...
... of the UNFCCC database and the NAPAs Like the latter, most cases are from sub-Saharan Africa, followed by South and Central Asia and Latin America, but in addition it shows that the vast majority ... Climate Change in Bangladesh The IFC clearly have the potential to play an important catalytic role in the objective of engaging the private sector in Climate Change Adaptation by both managing a ... interface which is a gateway to information on adaptation practices worldwide – the Local Coping Strategies Database It provides a summary of adaptation practices by a large range of organizations,...
... manager by the event manager Venue Choice (and audio visual) Suitability of the venue can mean more than just its layout and facilities Other facilities or amenities in the area and appropriateness ... seminars, where there is a specific need to gather many delegates and speakers together in one place, there are significant opportunities available for ensuring that environmental impacts are minimised ... also It is recommended that this guide is used to help select a suitable venue and to aid planning discussions with management and staff at the venue A copy should be passed tothe venue manager...