0

using a macro to open the wizard

Báo cáo

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo khoa học

... negative  impacts,  especially  in  the future,  when  the province has the plan to develop the aquaculture  to be the key sector of local economics [6].   A re a (h e c ta r s ) January  and  ... environment [3]. One of the disadvantages is  that  the relative  importance  of  evaluation  criteria is determined without considering the scales  on  which  the criteria  are  measured.  Another disadvantage is the large amount of  ... their  living;  they  need  to maintain  their  families.  Also  because  of  the relative  large  initial  investment costs they are in debt and have to repay the banks in short terms.  The ...
  • 13
  • 487
  • 0
Khóa luận tốt nghiệp tiếng anh: A study on using Role Play to motivate the 10th form students in speaking lessons at Lao Cai boarding upper secondary school, Lao Cai province –An experiment

Khóa luận tốt nghiệp tiếng anh: A study on using Role Play to motivate the 10th form students in speaking lessons at Lao Cai boarding upper secondary school, Lao Cai province –An experiment

Khoa học tự nhiên

... the foreign language Other reason is because of motivation lack to practice the second language in daily conversation They are also too shy and afraid to take part in the conversation Many factors ... motivation in language learning There are many factors that affect students’ motivation such as the teacher – related factors, student – related factors, materials, test and so on Oxford and Shearin ... taught in almost schools in Vietnam In respond to an appeal from social to improve the quality of education toward regional and international standards, language institutions are marking great...
  • 92
  • 3,794
  • 13
Báo cáo nghiên cứu khoa học:

Báo cáo nghiên cứu khoa học: "USING ADAPTIVE CONTROL TO SOLVE THE TRACKING PROBLEM FOR A MOBILE MANIPULATOR" pptx

Báo cáo khoa học

... of the manipulator torch tip on the x-y plane to the center C of platform, φ w is the heading angle in the horizontal plane of the welding torch, and φ C is the heading angle of the mobile platform ... on, and the manipulator has the duty of reaching to the altitude of the welding point 2.2 Kinematic Modeling for the Mobile Platform The kinematic equation of the platform can be described as the ... with respect to the tangent line of the welding trajectory at the welding point The rotation of the last link assures that the orientation of torch has a right gesture at the certain Trang TẠP CHÍ...
  • 11
  • 425
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Comparative embryology without a microscope: using genomic approaches to understand the evolution of development" potx

Báo cáo khoa học

... the result of adaptation between each species is calculated as a proxy for functional divergence relative to the underlying mutation rate One can then search for differences in the average value ... developmental divergence and conservation along branches leading to evolutionarily derived life histories can provide a deeper understanding of the role that adaptation has in shaping development Another ... genome-scale analyses [3-7] are beginning to provide insights into the action of selection across development, the approach faces several challenges One is that expression levels of many regulatory genes...
  • 4
  • 331
  • 0
báo cáo khoa học:

báo cáo khoa học: " Using knowledge brokers to facilitate the uptake of pediatric measurement tools into clinical practice: a before-after intervention study" docx

Báo cáo khoa học

... median) and factor loadings related to organizational characteristics and culture towards research, measurement and evidence-based practice Factor analysis of the nine items produced a three-factor ... mean Factor analysis produced a 3-factor solution explaining 72% of the variance The final question re: organizational resistance to change was a noisy item with an unexplained variance of 82% and ... Columbia, Canada Department of Physical Therapy, University of Alberta, Edmonton, Alberta, Canada 8School of Physical Therapy, The University of Western Ontario, London, Ontario, Canada Authors’...
  • 17
  • 423
  • 0
Báo cáo y học:

Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps

Báo cáo khoa học

... Sasaki S, Adra CN, Kitaichi M, Inoue H, Yamauchi K, Tomichi N, Kurimoto F, Hamasaki N, Hopkin JM, Izuhara K, Shirakawa T, Deichmann KA: Genetic variants of IL-13 signalling and human asthma and ... There is now an extensive and growing list of candidate genes investigated with regard to traits associated with asthma and atopy The most investigated candidate location for atopy and asthma ... (see Table 1); these databases are constantly updated and are growing rapidly However, the data contained in them are far from infallible and as yet there has been no systematic review of the accuracy...
  • 11
  • 491
  • 0
A study on using short stories to improve the effeciency of teaching speaking and listening skills to students at Haiphong Foreign Language Centre = Nghiên cứu

A study on using short stories to improve the effeciency of teaching speaking and listening skills to students at Haiphong Foreign Language Centre = Nghiên cứu

Sư phạm

... describe the two main characters: Della and Jim After that, the teacher gives each group a role-play situation and asks them to roleplay conversations between the characters according to the table ... in the story rather in the language  Role-playing: The students play the roles of some characters in the story, action out some scene in the story as assigned by the teacher The dialogues can ... learning to speak The desire to communicate with others, often face -to- face and in real time, drives them to attempt to speak fluently and correctly Many people equate being able to speak a language...
  • 48
  • 1,018
  • 2
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

Quản trị kinh doanh

... enables them to differentiate a brand from another 2.3.4 Brand loyalty According to Aaker (1991, p39), brand loyalty is the attachment that a customer has to a brand” Yoo and Donthun (2001) also ... can be generalize to all customer of McDonald and Max hamburger because the sample is small to represent all the actual customer of both restaurant and also the fact that the students lived together ... competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand commonly provide the...
  • 88
  • 986
  • 8
USING AUTHENTIC MATERIALS TO SUPPLEMENT THE COURSE BOOK ON ESP PROGRAM FOR SECOND YEAR MEDICAL STUDENTS AT HANOI MEDICAL UNIVERSITY

USING AUTHENTIC MATERIALS TO SUPPLEMENT THE COURSE BOOK ON ESP PROGRAM FOR SECOND YEAR MEDICAL STUDENTS AT HANOI MEDICAL UNIVERSITY

Khoa học xã hội

... language items (grammar and vocabulary) and consolidating language chances My knowledge background has been broaden thank to authentic materials 10 Post- reading activities help me to understand ... adults - Ask Ss to read the text - Ask Ss to tell what may cause Hepatitis and if it is more dangerous in children than in adults according to the text - Ask Ss to read the text again and answer ... Read the passage, and for each question, choose one best answer based on what is stated in the passage or on what can be inferred by circling A, B, C, or D Another critical factor that plays a...
  • 17
  • 790
  • 1
USING LANGUAGE GAMES TO MOTIVATE THE 10TH FORM NON ENGLISH MAJORS IN SPEAKING LESSONS AT PHAN BOI CHAU SPECIALIZING HIGH SCHOOL, NGHE AN

USING LANGUAGE GAMES TO MOTIVATE THE 10TH FORM NON ENGLISH MAJORS IN SPEAKING LESSONS AT PHAN BOI CHAU SPECIALIZING HIGH SCHOOL, NGHE AN

Khoa học xã hội

... in accuracy phase, not fluency phase I.2 Overview of language games I.2.1 What are language games? Language games can be used in language classes So what are games and what are language games? ... team (photo 2), the Italian national football team (photo 3) and the German national football team (photo 4) Then the teacher divides the class into groups namely: The English team’s fans, the French ... of the lesson once the target language has been introduced and explained They serve both as a memory aid and repetition drill and as a chance to use language freely, as a means to an end rather...
  • 54
  • 1,098
  • 7
Module 12: Using Group Policy to Manage the Desktop Environment

Module 12: Using Group Policy to Manage the Desktop Environment

Hệ điều hành

... deploy and manage software that is in the Windows Installer package file format The most important advantage of using software installation and maintenance technology is that you can manage and ... Enable users to run the New Task wizard to schedule an in-house tool to perform maintenance tasks on the order database Tasks Detailed steps Create a GPO for the Telemarketing organizational ... give administrators one major advantage: it combines the Windows Installer package files with the software installation and maintenance technology, so that administrators can easily deploy and manage...
  • 82
  • 515
  • 0
Tài liệu Using a DataView to Control Edits, Deletions, or Additions in Windows Forms pdf

Tài liệu Using a DataView to Control Edits, Deletions, or Additions in Windows Forms pdf

Quản trị mạng

... adding, editing, or deleting the data in the control Binding a DataGrid to a DataTable binds to the default view of the underlying DataTable The DataView class represents a view of the DataTable ... SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable dtOrders = new DataTable("Orders"); da.FillSchema(dtOrders, SchemaType.Source); ... sets a Boolean value indicating whether deletes are allowed AllowEdit Gets or sets a Boolean value indicating whether edits are allowed AllowNew Gets or sets a Boolean value indicating whether...
  • 3
  • 532
  • 0
Using language games to motivate the 11th graders in english speaking classes = sử dụng trò chơi chơi ngôn ngữ nhằm gây hứng thú cho học sinh lớp 11 trong các giờ học nói luận văn thạc sĩ giáo dục học

Using language games to motivate the 11th graders in english speaking classes = sử dụng trò chơi chơi ngôn ngữ nhằm gây hứng thú cho học sinh lớp 11 trong các giờ học nói luận văn thạc sĩ giáo dục học

Khoa học xã hội

... games 2.4.1 What are language games? Language games can be used in language classes So what are games and what are language games? First of all, what are games? Games are forms of entertainment derived ... receive information Normally, they are only asked to practice (role- play) and dramatize a dialogue or to talk about what they have to learn from a prose based on the previous answers at the end of ... Teaching a second language used to be aimed at enabling learners to read and appreciate class of literature Therefore, any teacher who was able to reach this aim was thought to be a good teacher...
  • 86
  • 1,653
  • 16
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Báo cáo khoa học

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, ... at the TP901-1 phage attachment site PCR products upstream to pyk using primer pyk1 (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to...
  • 12
  • 616
  • 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

Báo cáo khoa học

... scenario, the activation of growth factor receptors may in turn activate the Ras ⁄ Rac1 pathway, which has been shown to play a critical role in HSF1 activation and HSP up-regulation [14] We have reported ... [13] The overexpression of a desaturase gene in Saccharomyces cerevisiae, or the addition of exogenous fatty acids, can change the unsaturated ⁄ saturated fatty acid ratio and exert a significant ... Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a key mediator of both mitogenic and stress signaling pathways,...
  • 10
  • 452
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Using Similarity Scoring To Improve the Bilingual Dictionary for Word Alignment" doc

Báo cáo khoa học

... members of the same equivalence class The equivalence classes will depend on the target language at hand For instance, in German, a and a will be assigned to the same equiva¨ lence class, because some ... ¦ We trained three basic dictionaries using part of the Hansard data, around five megabytes of data (around 20k sentence pairs and 850k words) The basic dictionaries were built using the algorithm ... links: each word in the source language is paired with each word in the target language Then for each word pair the score is looked up in the dictionary, and the pairs are ranked from highest to lowest...
  • 8
  • 363
  • 0
Money and happiness a guide to living the good life

Money and happiness a guide to living the good life

Tâm lý - Nghệ thuật sống

... 2002, meaning they lack the means to ensure themselves of healthy meals and are vulnerable to at least a mild form of chronic malnutrition.3 WEALTH AND VALUES I live in a home that has heat and running ... excited to read the Financial Times,” she says with a laugh When she was 14, her parents started a restaurant, and she began waitressing at night Her father encouraged her to save up for substantial ... So that weekend I went to Saks locally and told them that I was in New York, had bought all this makeup, came home, and my husband had a fit They took it all back That’s so me—there was no way...
  • 258
  • 358
  • 0
A Strategy to Engage the Private Sector in Climate Change Adaptation in Bangladesh docx

A Strategy to Engage the Private Sector in Climate Change Adaptation in Bangladesh docx

Quỹ đầu tư

... of the UNFCCC database and the NAPAs Like the latter, most cases are from sub-Saharan Africa, followed by South and Central Asia and Latin America, but in addition it shows that the vast majority ... Climate Change in Bangladesh The IFC clearly have the potential to play an important catalytic role in the objective of engaging the private sector in Climate Change Adaptation by both managing a ... interface which is a gateway to information on adaptation practices worldwide – the Local Coping Strategies Database It provides a summary of adaptation practices by a large range of organizations,...
  • 49
  • 557
  • 0
Greener Events A guide to reducing the environmental impacts of conferences and seminars potx

Greener Events A guide to reducing the environmental impacts of conferences and seminars potx

Tổ chức sự kiện

... manager by the event manager Venue Choice (and audio visual) Suitability of the venue can mean more than just its layout and facilities Other facilities or amenities in the area and appropriateness ... seminars, where there is a specific need to gather many delegates and speakers together in one place, there are significant opportunities available for ensuring that environmental impacts are minimised ... also It is recommended that this guide is used to help select a suitable venue and to aid planning discussions with management and staff at the venue A copy should be passed to the venue manager...
  • 5
  • 527
  • 0

Xem thêm