using a high resolution terrain texture in unity
Báo cáo y học: " Triple X syndrome in a patient with partial lipodystrophy discovered using a high-density oligonucleotide microarray: a case report" doc
Ngày tải lên :
11/08/2014, 14:20
... valsartan, hydrochlorothiazide, rosuvastatin, ezetimibe, metformin, enteric coated acetylsalicylic acid (ASA), rabeprazole, amitriptyline, meloxicam, K-lyte, and magnesium On physical examination, ... have a case to share? Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach us something www.casesnetwork.com ... by the Jean Davignon Distinguished Cardiovascular-Metabolic Research Award (Pfizer, Canada) and Genome Canada through the Ontario Genomics Institute References Abbreviations AGPAT2, 1-acylglycerol-3-phosphate...
- 5
- 348
- 0
Báo cáo toán học: " Two-stage source tracking method using a multiple linear regression model in the expanded phase domain" pdf
Ngày tải lên :
20/06/2014, 20:20
... moving speaker tracking Generally, an LS-TDE in a single-frame-based process easily confronts the lack of data problem because the Yang and Kang EURASIP Journal on Advances in Signal Processing ... Received: 31 May 2011 Accepted: 10 January 2012 Published: 10 January 2012 References S Nakamura, K Hiyane, F Asano, Y Kaneda, T Yamada, TN Kobayashi, H Saruwatari, Design and collection of acoustic ... phase wrapping occurs the Gaussian assumption becomes invalid thus a delay estimator which does not include a maximum searching process easily fails Conventional linear regression model basically...
- 19
- 455
- 0
Báo cáo y học: "Construction of a high-resolution genetic linkage map and comparative genome analysis for the reef-building coral Acropora millepora" ppt
Ngày tải lên :
09/08/2014, 20:20
... local adaptation in A millepora Map density and recombination rate In the consensus map, marker density is dramatically variable across linkage groups, indicating that the protein-coding genes in ... Island and Great Keppel Island populations, respectively, despite the fact that only a few individuals were assayed Linkage mapping Linkage analysis was carried out using JoinMap 4.0 software ... drafted the manuscript All authors read and approved the final manuscript Additional data files The following additional data are available with the online version of this article: an Excel table...
- 17
- 268
- 0
Báo cáo y học: "Storage and allogeneic transplantation of peripheral nerve using a green tea polyphenol solution in a canine model'''' ppsx
Ngày tải lên :
10/08/2014, 10:20
... female animals Each animal was acclimatized before the surgical procedures, housed in a separate cage, and given standard dog food and water three times a day All experiments were performed in accordance ... nerves remained in the nerve allografts in the PA0.1 and PA0.05 groups but that no cells of donor origin survived in the nerve allografts in the PA0.025 group Nakayama et al Journal of Brachial Plexus ... Tacrolimus, an update of its pharmacology and clinical efficacy in the management of organ transplantation Drug 1997, 54:925 12 Undre NA, Stevenson P, Schafer A: Pharmacokinetics of tacrolimus: clinically...
- 8
- 400
- 0
báo cáo khoa học: "Journal of Hematology & Oncology BioMed Central Short report Open Access Detection of NPM1 exon 12 mutations and FLT3 – internal tandem duplications by high resolution melting analysis in normal karyotype acute myeloid leukemia" docx
Ngày tải lên :
10/08/2014, 22:20
... Normal Normal Normal Aberrant Normal Normal Normal Normal Normal Normal Aberrant Normal Aberrant Aberrant Normal Normal Normal Normal Normal Normal Normal Normal Aberrant Normal Aberrant Normal ... Normal Normal Normal Aberrant Normal Normal Normal Normal Normal Normal Normal Normal Normal Aberrant Normal Normal Normal Aberrant Normal Normal Aberrant Normal Normal Aberrant Normal Normal ... containing 400 nM each of the relevant forward and reverse primer (NPMex12FTGATGTCTATGAAGTGTTGTGGTTCC, NPMex12RCTCTGC ATTATAAAAAGGACAGCCAG; or FLT3ex14FTGCAGAACTGCCTATT CCTAACTGA; FLT3ex14R-TTCCATAAGCTGTTGCGTTCATCAC,...
- 5
- 236
- 0
Báo cáo y học: "Causes of a high physiological dead space in critically ill patients" ppt
Ngày tải lên :
13/08/2014, 11:22
... Critical Care Vol 12 No Wagner Figure changes in dead space may reflect changes in cardiac output or acid/base state rather than changes in the shunt itself In summary, the calculations of Niklason ... reduction in cardiac output and, separately, acidosis This also means that a high cardiac output will reduce the dead space effect of shunt, as will alkalosis The clinical message is that observed Page ... that, for any given value of shunt, additional perturbations commonly seen in the intensive care unit influence arterial pCO2 and therefore will increase calculated dead space These include a reduction...
- 2
- 211
- 0
Survey of cellular factors modulating the HIV 1 integration complex activity using a unique protein screening system in vitro
Ngày tải lên :
01/10/2015, 17:27
... An additional PCR was performed using a common set of forward (5’GGGGACAAGTTTGTACAAAAAAGCAGGCTgcgaattcatcgatagatctgat-3) and reverse (5’GGGGACCACTTTGTACAAGAAAGCTGGGTCctacttgtcatcgtcatccttg-3’) ... with DNA Facilitate chromatin engagement by viral cDNA before integration Phosphorylates BAF causing its dissociation from PIC and affecting strand-transfer Emerin VRK1 Vacciniarelated kinases ... integration assay via displacement of IN Co-immunoAcetylates IN to precipitation enhance DNA affinity and integration Yeast twoInhibits integration hybrid screening by decreasing IN acetylation References...
- 125
- 395
- 0
Christoph bollmeyer a HIGH RESOLUTION REGIONAL REANALYSIS FOR EUROPE AND GERMAN CREATION AND VERIFICATION WITH a SPECIAL FOCUS ON THE MOISTURE BUDGET
Ngày tải lên :
26/11/2015, 10:11
... analyses for a given past time span on a predefined domain with all available observations assimilated in the model Most reanalyses are available for a global domain such as ERA40 (Uppala et al., ... The model variables are staggered on an Arakawa-C-grid (Arakawa and Lamb, 1981; Arakawa and Lamb, 1977) where all scalar variables Ψ are defined in the grid centre at (i, j, k) whereas the components ... Daily mean averages of hourly aggregated and area-averaged analysis increments for temperature 4.2 Daily mean averages of hourly aggregated and area-averaged analysis...
- 124
- 637
- 0
AN1476 combining the CLC and NCO to implement a high resolution PWM
Ngày tải lên :
11/01/2016, 16:57
... worldwide headquarters, design and wafer fabrication facilities in Chandler and Tempe, Arizona; Gresham, Oregon and design centers in California and India The Company’s quality system processes and procedures ... 949-462-9523 Fax: 949-462-9608 Santa Clara Santa Clara, CA Tel: 408-961-6444 Fax: 408-961-6445 Toronto Mississauga, Ontario, Canada Tel: 905-673-0699 Fax: 905-673-6509 Australia - Sydney Tel: ... NCO BASED PWM OPERATION 2012 Microchip Technology Inc AN1476 In any application where the output is producing an average value (e.g., average power transfer to the load in SMPS or lighting applications),...
- 10
- 230
- 0
Waste heat recovery using a thermoelectric power generation system in a biomass gasifier
Ngày tải lên :
01/08/2016, 09:31
... burned as waste In this study, the Japanese cedar waste material is used as fuel to test a downdraft gasifier Table shows the characteristics of Japanese cedar, showing that Japanese cedar has a high ... combustible gas, such as H2 and CO The variation of the cold gas efficiency and higher heating value of syngas produced from Japanese cedar gasification with the ER is calculated by using the each heating ... http://dx.doi.org/10.1016/j.applthermaleng.2014.09.070 H.-K Ma et al / Applied Thermal Engineering xxx (2014) 1e6 Table Proximate and ultimate analysis of Japanese cedar Property Japanese cedar Proximate analysis...
- 6
- 367
- 0
Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf
Ngày tải lên :
23/06/2014, 01:20
... devoted to a high- resolution radar application The goal is to find the most accurate estimate of the range profile of a radar target using its complex signature in the frequency domain An Estimation ... particularly important in superresolution radar imagery applications, where underestimation has to be always avoided because it leads to lost scattering centers in the reconstructed image of the radar ... estimate, the eigenvalue variation can be still used, in a different form, for obtaining N The main idea behind the new method is that estimating N is equivalent to finding how many eigenvalues are...
- 12
- 409
- 0
Báo cáo y học: " Ring chromosome 13 syndrome characterized by high resolution array based comparative genomic hybridization in patient with 47, XYY syndrome: a case report." doc
Ngày tải lên :
11/08/2014, 00:22
... the 96 hapmap Asian individuals used as control Initial analysis and quality assessment of the array data were performed with Genotyping Console (Affymetrix, CA, USA) The median absolute pair-wise ... and structural chromosomal abnormalities which are characterized by a high resolution array based comparative genomic hybridization (aCGH) Case presentation Our patient was a 10-month old Chinese ... be having hearing impairment which was in accordance with our patient’s deafness We also noted that hearing impairment association with 13q deletion was reported in an animal model [16] In their...
- 4
- 294
- 0
Using a model-based approach to teach English writing to 10th graders in Ba Dinh high school, Nga Son, Thanh Hoa = Sử dụng bài viết mẫu để dạy viết tiếng Anh ch
Ngày tải lên :
30/03/2015, 14:31
... (listening, speaking, reading, and writing) so that Vietnamese, L2 students are able to communicate well in the target language However, teaching-learning quality at many places is still far from ... approach into teaching composition in a real classroom Practically, the research provides language teachers and learners with a number of activities and exercises using the model-based approach ... (1983), there are six approaches to teaching writing, namely: The Controlled-to-Free Approach, The Free-Writing Approach, The Paragraph-Pattern Approach, The Grammar-Syntax-Organization Approach, The...
- 55
- 551
- 0
Assessing regional hydro climate impacts using high resolution climate modelling a study over vietnam
Ngày tải lên :
11/09/2015, 14:31
... such an intricate science as that of climate Invariably, the datasets and models are all derived from European or American research, and in more recent years, from China, Japan and Australia It ... vulnerability of subnational administrative areas in 12 seven countries of Southeast Asia - Vietnam, Laos, Cambodia, Thailand, Malaysia, the Philippines and Indonesia Climate hazards comprising floods, ... Southeast Asian countries (Thailand, Vietnam, Indonesia), massive flooding in Hanoi and Hue (Vietnam), Bangkok (Thailand), Jakarta (Indonesia), Vientiane (Laos), landslides in 11 the Philippines and...
- 222
- 263
- 0
using powerpoint lessons for teaching grammar in a noncentered high schoo
Ngày tải lên :
27/12/2015, 10:51
... as being more visually appealing and interesting than the traditional methods like overhead transparencies and handouts In addition, presentation software can provide a variety of color, Using ... particular language is the grammar of that language, in another word grammar is the study of rules governing the use of the language Using Powerpoint Lessons for teaching Grammar in a non-centered high ... formal study of grammar is an important part of education from a young age through advanced learning; however, grammar, historically, has been taught in a manner that leaves learners wondering...
- 37
- 363
- 0
Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"
Ngày tải lên :
26/10/2012, 09:48
... Tarumi Y, Kadomatsu K, and Takei Y Systemic delivery of siRNA specific to tumor mediated by atelocollagen: Combined therapy using siRNA targeting Bcl-xL and cisplatin against prostate cancer Int ... DNA-damaging interventions like exposition to ionizing radiation and after chemotherapeutic alkylation [52], whereas the latter part of the S phase is highly sensitive against DNA-damaging effectors.[53] ... cell cycle activating pathways but also by the inactivation of cell death associated signals resulting in the loss of the proliferation control and in the augmented resistance against apoptosis...
- 10
- 408
- 0
Báo cáo y học: "Study of urban community survey in India: growing trend of high prevalence of hypertension in a developing country"
Ngày tải lên :
02/11/2012, 11:12
... myocardial ischemia Salt intake was assessed from the amount of salt used in cooking and extra salt used during meal Statistical Analysis We used EPI-INFO-2002 software for data entry and analysis ... Health in India He is both an otolaryngologist and an epidemiologist Dr Basu graduated in the year 1990 from Medical College, Calcutta, India and had further graduate training in otolaryngology and ... sample in Kerala India National Medical Journal of India 2000; 13: 9-15 Shanthirani CS, Pradeepa R, Deepa R, Premalatha G, Saroja R, Mohan V Prevalence and risk factors of hypertension in a selected...
- 9
- 492
- 0
Natural botanical products have a long history in the world and are featured in using a complex
Ngày tải lên :
03/11/2012, 09:54
... hormone-refractory prostate carcinoma cells: mechanistic studies Int J Oncol 2002, 20:681-9 Yasukawa K, Ikeya Y, Mitsuhashi H, Iwasaki M, Aburada M, Nakagawa S, Takeuchi M, Takido M Gomisin A inhibits ... ultrasound-guided intratumoral injection of "Star-99" in treatment of hepatocellular carcinoma of nude mice World J Gastroenterol 2003, 9: 701-5 Nandakumar KS, Lakshmi Rao K, Pardhasaradhi BV, Khar A Upregulation ... 12-O-tetradecanoylphorbol-13acetate in two-stage carcinogenesis in mouse skin Oncology 1992, 49:68-71 Chang YS, Seo EK, Gyllenhaal C, Block KI Panax ginseng: a role in cancer therapy? Integr Cancer...
- 9
- 712
- 0
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
Ngày tải lên :
03/11/2012, 11:44
... Abbreviations AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized ... defective (5) and insufficient (6) Y-axis: Percentage of patients Panel A: AVNRT Panel B: AVRT Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying the ... EAT patients Panel A: Quantity and duration of episodes and the associated symptoms Panel B: Detraction in daily life generally and in parts of daily life variable PANAL A Detraction in daily...
- 9
- 679
- 0