using a custom monitor view in an event automation plan to report cluster drive data using drive letter names

Báo cáo hóa học: " Results of Clinicians Using a Therapeutic Robotic System in an Inpatient Stroke Rehabilitation Unit" potx

Báo cáo hóa học: " Results of Clinicians Using a Therapeutic Robotic System in an Inpatient Stroke Rehabilitation Unit" potx

Ngày tải lên : 19/06/2014, 08:20
... familiar Canadian measure, the CMSA This impairment measure divides arm and hand recovery into separate motor stages (1-7), allowing patients to be placed in similar bins as well as allowing researchers ... assistant in today’s physical therapy centres Individuals’ data may be objectively recorded, helping therapists and physicians monitor and evaluate the patient’s progress and the treatment intervention ... paralysis, Stage showing beginning of tone with movement being able to be facilitated, whereas Stage indicates that the individual can move Abdullah et al Journal of NeuroEngineering and Rehabilitation...
  • 12
  • 368
  • 0
Students perceptions of using portfolios as a means of evaluation in an english foreign language translation course

Students perceptions of using portfolios as a means of evaluation in an english foreign language translation course

Ngày tải lên : 30/11/2015, 09:14
... STATEMENT OF AUTHORSHIP Title: Students’ Perceptions of Using Portfolios as a Means of Evaluation in an English Foreign Language Translation Course, a Case Study at the Faculty of Foreign Languages, ... ABSTRACT The purpose of this study is to investigate students’ perceptions of benefits of using portfolios as a means of evaluating their learning process in a translation course and find ... of Foreign Languages, Hanoi Pedagogical University Number As a result, most of students have positive attitudes and motivations towards the effects of using portfolios in their learning process;...
  • 7
  • 361
  • 1
Tài liệu Creating a Class That Participates in an Automatic Transaction ppt

Tài liệu Creating a Class That Participates in an Automatic Transaction ppt

Ngày tải lên : 24/12/2013, 05:15
... automatically in an existing transaction, to start a new transaction, or to not participate in a transaction The following steps prepare a class to participate in an automatic transaction: Derive the class ... transactions that span multiple remote databases and multiple resource managers Objects participating in automatic transactions not need to anticipate how they might be used within a transaction ... automatic transaction Once an object is marked to participate in a transaction, it will automatically execute within a transaction The object's transactional behavior is controlled by the value...
  • 5
  • 410
  • 0
Tài liệu Make a Generic Search Form in an ASP.NET docx

Tài liệu Make a Generic Search Form in an ASP.NET docx

Ngày tải lên : 24/12/2013, 06:17
... buttonface TextBox Name Label1 Text Click on a Letter Panel Name Panel1 Button Name btnA Caption A Name btnB Caption B Name btnC Caption C Button Button Button btnAll All Name dgSearch True Name ... ByVal e As System.Web.UI.WebControls.DataGridPageChangedEventArgs) Handles dgSearch.PageIndexChanged ' Set the current page in the data grid Me.dgSearch.CurrentPageIndex = e.NewPageIndex BindTheGrid() ... btnAccept Caption &Accept Name btnCancel Caption Button Name AllowPaging Button Z Caption DataGrid btnZ Caption Button Name &Cancel In the class module for the Web Form, add the following Private...
  • 12
  • 451
  • 0
Báo cáo y học: "Duration of bed occupancy as calculated at a random chosen day in an acute care ward. Implications for the use of scarce resources in psychiatric care" pps

Báo cáo y học: "Duration of bed occupancy as calculated at a random chosen day in an acute care ward. Implications for the use of scarce resources in psychiatric care" pps

Ngày tải lên : 08/08/2014, 21:20
... requires excess capacity, probably higher than necessary from a public point of view The American health financial system is organised with a tilt towards shorter waiting times, and thus towards higher ... who, after an examination by an external doctor are found to be in danger of severely damaging own life or other people's lives Reasons for referrals are acute psychosis, mania, or severe suicidal ... treatment, and did not accumulate waiting days We have not tried to aggregate our results to an effect for a longer period of time, as this would demand more data on both costs and incomes to the...
  • 6
  • 505
  • 0
Báo cáo khoa học: "Relationship of cognitive function in patients with schizophrenia in remission to disability: a cross-sectional study in an Indian sample" pps

Báo cáo khoa học: "Relationship of cognitive function in patients with schizophrenia in remission to disability: a cross-sectional study in an Indian sample" pps

Ngày tải lên : 08/08/2014, 23:20
... Srinivasan L, Thara R, Tirupati SN: Cognitive dysfunction and associated factors in patients with chronic schizophrenia Indian J Psychiatry 2005, 47:139-143 Ananthanarayanan CV, Janakiramaiah N, Gangadhar ... Assessment of Psychiatric Disability (SAPD), which has been standardized in the Indian population Statistical analysis Data was analyzed using SPSS v 12 [27] Data were checked for normality using ... Assessment Scale) – A Scale for Measuring and Quantifying Disability in Mental Disorders Chennai: Indian Psychiatric Society; 2002 American Psychiatric Association: Diagnostic and Statistical Manual of...
  • 8
  • 397
  • 0
Báo cáo y học: "Atrophy of the brachialis muscle after a displaced clavicle fracture in an Ironman triathlete: case report" docx

Báo cáo y học: "Atrophy of the brachialis muscle after a displaced clavicle fracture in an Ironman triathlete: case report" docx

Ngày tải lên : 10/08/2014, 10:20
... free of pain and continued training Four months after the operation the radiological examination was repeated (see Figure 1Panel C and D) and the nail was removed In the meantime the pain was gone ... process, and the attending doctor has to base his decision on the demands of the patient In this case one of the athlete’s most important aims was to be able to continue his training and to participate ... participate in competitions again, as soon as possible Considering the athlete’s wishes as well as his general condition and compliance, a treatment with medullary nailing was certainly indicated and was...
  • 4
  • 319
  • 0
báo cáo khoa học: "Amyand’s hernia-a vermiform appendix presenting in an inguinal hernia: a case series" ppt

báo cáo khoa học: "Amyand’s hernia-a vermiform appendix presenting in an inguinal hernia: a case series" ppt

Ngày tải lên : 10/08/2014, 23:20
... and AT edited and wrote part of the manuscript KB and TP were major contributors to reviewing and editing the manuscript AS made the strategic plan and gave the final approval All authors read ... within an inguinal hernia, related or unrelated abdominal pathology Manage as types to hernia, investigate or treat second pathology as appropriate Psarras et al Journal of Medical Case Reports ... all clinical settings and an appropriate and individualized approach should be applied Page of References Amyand C: Of an inguinal rupture, with a pin in the appendix caeci, incrusted with stone;...
  • 3
  • 306
  • 0
Báo cáo y học: "Bleeding from ruptured hepatic metastases as a cause of syncope in an octogenarian: a case report" pdf

Báo cáo y học: "Bleeding from ruptured hepatic metastases as a cause of syncope in an octogenarian: a case report" pdf

Ngày tải lên : 11/08/2014, 12:20
... hemoperitoneum An acute intra-abdominal bleed from the liver metastatic disease was diagnosed Our patient had an esophageal gastro-duodenal endoscopy as he had been taking aspirin and had a past history ... Dewar GA, Griffin SM, van Hasselt CA, et al.: Fatal haemoperitoneum due to liver metastases from nasopharyngeal cancer Aust N Z J of Surg 1991, 61(9):723-725 Yoshida H, Mamada Y, Taniai N, et al.: ... Intra-peritoneal hemorrhage frequently presents with acute abdominal pain and can be life-threatening CT is commonly used as an imaging modality in the investigations of these patients, but ultrasound...
  • 3
  • 372
  • 0
Báo cáo y học: "Dantrolene and heatstroke: a good molecule applied in an unsuitable situation" ppsx

Báo cáo y học: "Dantrolene and heatstroke: a good molecule applied in an unsuitable situation" ppsx

Ngày tải lên : 12/08/2014, 20:20
... therapeutic care may benefit from advances in sepsis management, in that both syndromes share some pathophysiological similarities: cytokine and acute-phase protein production, coagulation disorders and, ... context of CHS, a disease frequently associated with hepatic failure and/or disseminated intravascular coagulation [6] Second, there are some experimental animal studies reporting negative inotropic ... patient into the hands of an expert ‘cooling team’ as quickly as possible In order to initiate patient cooling earlier, prehospital emergency care (Service d’Aide Médicale d’Urgence; SAMU) and rescue...
  • 2
  • 212
  • 0
Bóa cáo y học: " Early apoptosis of blood monocytes in the septic host: is it a mechanism of protection in the event of septic shock" ppt

Bóa cáo y học: " Early apoptosis of blood monocytes in the septic host: is it a mechanism of protection in the event of septic shock" ppt

Ngày tải lên : 12/08/2014, 23:23
... findings pointed towards a predominance of Gram-negative bacteria as responsible pathogens and towards a monomicrobial cause of VAP (Table 1) It was proved that apoptosis is a phenomenon taking ... Resolution of VAP was considered as any decrease of X-ray findings accompanied by an increase of the pO2/FiO2 ratio Antimicrobial therapy of VAP was selected by attending physicians according to published ... Jr, Amado VM, Caserta R, Dalla Valle Martino M, Pasternak J, et al.: Ventilator associated pneumonia: comparison between quantitative and qualitative cultures of tracheal aspirates Crit Care...
  • 8
  • 350
  • 0
Báo cáo y học: "Cost-effectiveness of a hypertension management programme in an elderly population: a Markov model" ppt

Báo cáo y học: "Cost-effectiveness of a hypertension management programme in an elderly population: a Markov model" ppt

Ngày tải lên : 13/08/2014, 11:22
... and design; GP, ER, GW and CA participated in the collection and assembly of data; GP, ER, GW, CA, CG, CP and ES contributed to analysis and interpretation of data; all authors participated in ... the same health state without suffering any event; b) Have an acute cardiovascular event (acute myocardial infarction -AMI-, unstable angina -UA-, ischaemic stroke, haemorrhagic stroke, transient ... men A metaanalysis of individual patient data from randomized, controlled trials The INDANA Investigators Ann Intern Med 1997, 126(10):761-767 11 Neal B, MacMahon S, Chapman N: Effects of ACE inhibitors,...
  • 11
  • 285
  • 0
Báo cáo sinh học: " Detection of multiple QTL with epistatic effects under a mixed inheritance model in an outbred population" pot

Báo cáo sinh học: " Detection of multiple QTL with epistatic effects under a mixed inheritance model in an outbred population" pot

Ngày tải lên : 14/08/2014, 13:22
... cases, where the means, medians and modes 424 A Narita, Y Sasaki Table II The true values of the parameters set in respective cases Parametera case l/m case l/m θ a d aa ad da dd case l/m θ a ... simultaneously taken into account Since Bayesian approaches via MCMC algorithms have been generally used as an alternative to maximum-likelihood and least squares methods, several methods to detect ... model and to retaining the appropriate mixing behavior, effect indicators, which take a value one if QTL have significant main effects and zero otherwise, were used as additional parameters in the...
  • 19
  • 211
  • 0
Intravesical tumor necrosis factor alpha gene therapy mediated by a novel liposome system in an orthotopic murine bladder cancer model

Intravesical tumor necrosis factor alpha gene therapy mediated by a novel liposome system in an orthotopic murine bladder cancer model

Ngày tải lên : 08/11/2015, 16:45
... sincerest thanks and deepest appreciation to my supervisors: A/ P Kesavan Esuvaranathan and Dr Ratha Mahendran for their constant guidance, support and encouragement throughout this project and ... models and the clinical trials are under going in various cancer patients such as 20 melanoma, renal cell carcinoma, colon cancer, lung cancer, brain tumor and lymphoma In spite of the unique anatomy ... Grant Award), 6th Annual Meeting of American Society of Gene Therapy, June 4-8, 2003, Washington, DC Zang Z, Mahendran R, Esuvaranathan K liposome-mediated cytokine gene therapy in bladder cancer...
  • 121
  • 180
  • 0
AN0792   a method to determine how much power a SOT23 can dissipate in an application

AN0792 a method to determine how much power a SOT23 can dissipate in an application

Ngày tải lên : 11/01/2016, 11:40
... resistance alone insignificant Industry Standard Thermal Resistance Measurements Industry standards exist as a means to standardize the measurement of thermal resistance Standards organizations ... semiconductor junction, package case, electrically insulating material, heatsink and air In most applications, heat or energy can be approximated as a single point source and flows through the material ... Thermal Resistance? Many factors influence the flow of heat They can be broken up into two types, internal factors and external factors The internal factors are device package size, die size, package...
  • 10
  • 392
  • 0
Báo cáo y học: "A role of ygfZ in the Escherichia coli response to plumbagin challenge" pdf

Báo cáo y học: "A role of ygfZ in the Escherichia coli response to plumbagin challenge" pdf

Ngày tải lên : 10/08/2014, 05:21
... PygfZk226AR pQE-Rv_0811c CGGTATAACAGCCGGCCTTAAAGCTG PygfZG227AF CTTTAAGAAAGCCTGTTATACCGGAC PygfZG227AR pQE-ygfZK22 6A GTCCGGTATAACAGGCTTTCTTAAAG pQE-ygfZG22 7A PygfZC228AF CTTTAAGAAAGGGGCTTATACCGGACAAG ... open reading frame annotated as an aminomethyltransferase-related gene [27], was used in a similar complementation assay, the plumbagin resistance in the ΔygfZ strain was regained partially (Figure ... GTCCGGTATACATGCCTTTCTTAAAG PygfZY229AF TAAGAAAGGCTGTGCTACCGGACAAG PygfZY229AR CTTGTCCGGTAGCACAGCCTTTCTTA PygfZT230AF AAGGCTGTTATGCCGGACAAGAGATG PygfZT230AR pQE-ygfZC228M pQE-ygfZY22 9A CATCTCTTGTCCGGCATAACAGCCTT...
  • 13
  • 440
  • 0
Báo cáo sinh học: "Genome-assisted prediction of a quantitative trait measured in parents and progeny: application to food conversion rate in chickens" potx

Báo cáo sinh học: "Genome-assisted prediction of a quantitative trait measured in parents and progeny: application to food conversion rate in chickens" potx

Ngày tải lên : 14/08/2014, 13:21
... the manuscript AK gained access to the dataset, participated in preparing and editing data, discussions and helped revise the manuscript All authors read and approved the final manuscript Acknowledgements ... York: Springer; 2006:55-56 Wahba G, Lin Y, Lee Y, Zhang H: Optimal properties and adaptive tuning of standard and non-standard support vector machines In Nonlinear estimation and classification ... obtained for this study because the data were obtained from an existing database supplied by Aviagen Ltd (Newbridge, UK) In a nutshell, a one-fold cross-validation with a training set and a testing...
  • 10
  • 371
  • 0
Báo cáo " A NEW VIEW ON AN OLD PROBLEM IN QUANTUM CHROMODYNAMICS " potx

Báo cáo " A NEW VIEW ON AN OLD PROBLEM IN QUANTUM CHROMODYNAMICS " potx

Ngày tải lên : 05/03/2014, 14:20
... (8) τ a Aa ; Fµν = ∂µ A − ∂ν A + [A A ] 2i with the constraint equation equation δS/δAa = has been made in [13] According to this paper the quantization of only the transverse fields AT and ... dimensional transmutation parameter - the analog of the arrangement energy resolution in QED (Recall that the old renormalization group QCD parameter Λ was also defined by a nonperturbative interaction ... breaking in the asymptotic desert region than the infrared nonperturbative interaction We suggested the new infrared mechanism of dimensional transmutation that is omitted in the conventional approach...
  • 7
  • 349
  • 0
Báo cáo y học: " Treatment of stasis dermatitis using aminaphtone: New-onset headache in an elderly man with uremia that improved only after correction of hyperphosphatemia (“uremic headache”): a case report" potx

Báo cáo y học: " Treatment of stasis dermatitis using aminaphtone: New-onset headache in an elderly man with uremia that improved only after correction of hyperphosphatemia (“uremic headache”): a case report" potx

Ngày tải lên : 11/08/2014, 00:22
... There was evidence of a space occupying lesion on CT scan of head There was no history of neuralgias and cerebrovascular disease Absence of response to antidepressants, various anticonvulsants, and ... onset at an elderly age is a prominent symptom in as many as one in six persons and often has a more serious import than a headache in a younger person Although around 40% of the elderly have tension ... case report and accompanying images A copy is available for review by the Editorin-Chief of this journal Razdan et al Journal of Medical Case Reports 2011, 5:77 http://www.jmedicalcasereports.com/content/5/1/77...
  • 3
  • 318
  • 0
Báo cáo y học: " Profile of subjective quality of life and its correlates in a nation-wide sample of high school students in an Arab setting using the WHOQOL-Bref" pot

Báo cáo y học: " Profile of subjective quality of life and its correlates in a nation-wide sample of high school students in an Arab setting using the WHOQOL-Bref" pot

Ngày tải lên : 11/08/2014, 15:22
... sample using an internationally validated instrument, based on a conceptual framework, and we analyzed our data in such a way as to make QOL data clinically relevant as a population health measure ... following played invaluable roles in data collection: Zaina Al-Zabin, Nahed Kamel, Abdel W Awadalla, and Sumai (and Ministry of Education Headquarters counseling unit staff) Joy Wilson for data entry ... regression analyses showed that variables from the personal factors (age and sex), parental factors (parental marital status and father’s occupation), general health factors (self-esteem, anxiety and...
  • 12
  • 500
  • 0