users apos expectation of a virtual philosopher system
INVESTIGATION OF THE FUNCTIONS OF p23 AND COAT PROTEIN OF HIBISCUS CHLOROTIC RINGSPOT VIRU
Ngày tải lên :
10/09/2015, 09:03
... luciferase protein and miR-21 RNA are generated at the same time (Cai et al., 2004) 1.5 Nuclear localization signal A nuclear localization signal (NLS) is an amino acid sequence which serves as a ... quality quantitative data - The assays can detect and quantify miRNA over more than six logs of dynamic range (2) Sensitivity - The assays can detect miRNAs in as little as to 10 ng of total ... was placed on the DNA-containing surface of the gel A pipette was used to eliminate air bubbles as above * The blot assembly was completed by adding a dry sheet of whatman MM paper, a stack of...
- 223
- 1.5K
- 0
báo cáo khoa học: " Profiling microRNA expression in Arabidopsis pollen using microRNA array and real-time PCR" pps
Ngày tải lên :
12/08/2014, 03:20
... City, CA) 5S rRNA Forward: 5'-CGATGAAGAACG TAGCGAAATG-3'; 5S rRNA Reverse: 5'-CTCGATGGTTCACGGGATTC-3'; Taqman Probe: 5'-TACTTGGTGTGAATTGC-3' TURBO DNase-treated RNA samples were converted to cDNA ... http://www.biomedcentral.com/1471-2229/9/87 Table 1: Comparison of miRNA expression using MiRCURY array and TaqMan miRNA assay MiRCURY Array£ Taqman MiRNA Assay¥ log2(sample/pool) MP CT Inf CT AS Slotkin et al€ Name ... plant materials grown under the same conditions For Taqman miRNA assay, each RNA sample was reverse transcribed as described above and the assay for each miRNA target was set up in triplicate...
- 10
- 324
- 0
Báo cáo khoa học: " A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR" potx
Ngày tải lên :
12/08/2014, 04:21
... attachment to CAR, a 46-kDa transmembrane protein that also serves as a receptor for many adenoviruses [17] In addition, some strains of CVB1, and can interact with an additional receptor, DAF, ... amounts of cells and viruses Statistical analyses Individual data pairs were analysed by the unpaired t test, and one-way analysis of variance followed by Dunnetts post-test was used to compare ... Conclusion This article describes a straightforward, rapid and robust method that with high accuracy can be used to quantify viral attachment, as an alternative to traditional methods We are grateful...
- 6
- 230
- 0
Báo cáo sinh học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pdf
Ngày tải lên :
18/06/2014, 18:20
... Genomics 2001, 7(2):97-104 Warrington JA, Nair A, Mahadevappa M, Tsyganskaya M: Comparison of human adult and fetal expression and identification of 535 housekeeping/maintenance genes Physiol Genomics ... the assay to detect changes in the expression of genes of interest and may also produce artificial changes [3] Traditionally glyceraldehyde 3phosphate dehydrogenase (GAPDH) and β-actin (BACT) have ... rates: Kavitha Gowrishankar and Elizabeth Sloan (VZV), Winnie Garcia (CMV), Debbie Ko (HSV-1), and Judith Edmonds, Sarah Sherwood, Sabine Piller and Valerie Marsden (HIV-1) The authors are grateful...
- 5
- 481
- 0
Báo cáo sinh học: " Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc
Ngày tải lên :
18/06/2014, 22:20
... Acknowledgements We gratefully acknowledge the excellent technical assistance of Delia Barz and Jung-Won Sim-Bandenburg The authors are grateful to Andreas Kurth for critical reading of the manuscript References ... RNA was extracted The RNA transcription level of putative reference genes was determined by quantitative real-time PCR as described below Extraction of RNA Total RNA from × 106 cells was prepared ... read and approved the final manuscript Material and Methods Virus culture and virus detection by real-time PCR Camelpox strain CP-19, CMV strain AD169, HHV-6 strain U1102, SARS coronavirus strain...
- 5
- 452
- 0
Báo cáo sinh học: " Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" potx
Ngày tải lên :
19/06/2014, 08:20
... common aetiological agent of GUD [5] Studies of HSV-2 seroprevalence have found high rates in African-Americans [6] and in African populations in Uganda, Zimbabwe, Tanzania, Central African Republic, ... are appropriate in asymptomatic cases, when viral culture and PCR assays are largely negative [15] Several commercially available HSV-type specific serological assays are available, but a test ... the addition of M13 primer sequences [HSV-M13 forward 5'-TGTAAAACGACGGCCAGTAGCCTGTAC- http://www.virologyj.com/content/2/1/61 CCCAGCAT-3'; HSV-M13 reverse 5'-CAGGAAACAGCTATGACCTGGGCCTTCACGAAGA-3']...
- 10
- 458
- 0
Báo cáo sinh học: " Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" pptx
Ngày tải lên :
19/06/2014, 08:20
... determination of JC viral load A – C: Analysis of HA and quantitative real-time PCR data employed for the determination of JC viral load JCV (Mad1), propagated in Dr Walker's laboratory (I) or propagated ... between real-time PCR and HA assays for the determination of JC viral load JCV(Mad1) was propagated in primary human fetal glial (PHFG) cells and purified in Dr Duard Walker's laboratory (I) ... agglutination and traditionally, hemagglutination (HA) and HA inhibition (HAI) assays have been employed for quantitation of JCV [8-14] However, the HA assay is poorly sensitive and the in vitro quantitation...
- 5
- 358
- 0
Báo cáo hóa học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pot
Ngày tải lên :
20/06/2014, 01:20
... Genomics 2001, 7(2):97-104 Warrington JA, Nair A, Mahadevappa M, Tsyganskaya M: Comparison of human adult and fetal expression and identification of 535 housekeeping/maintenance genes Physiol Genomics ... the assay to detect changes in the expression of genes of interest and may also produce artificial changes [3] Traditionally glyceraldehyde 3phosphate dehydrogenase (GAPDH) and β-actin (BACT) have ... rates: Kavitha Gowrishankar and Elizabeth Sloan (VZV), Winnie Garcia (CMV), Debbie Ko (HSV-1), and Judith Edmonds, Sarah Sherwood, Sabine Piller and Valerie Marsden (HIV-1) The authors are grateful...
- 5
- 574
- 0
báo cáo hóa học:" Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc
Ngày tải lên :
20/06/2014, 04:20
... Acknowledgements We gratefully acknowledge the excellent technical assistance of Delia Barz and Jung-Won Sim-Bandenburg The authors are grateful to Andreas Kurth for critical reading of the manuscript References ... RNA was extracted The RNA transcription level of putative reference genes was determined by quantitative real-time PCR as described below Extraction of RNA Total RNA from × 106 cells was prepared ... read and approved the final manuscript Material and Methods Virus culture and virus detection by real-time PCR Camelpox strain CP-19, CMV strain AD169, HHV-6 strain U1102, SARS coronavirus strain...
- 5
- 539
- 0
báo cáo hóa học:" Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" pdf
Ngày tải lên :
20/06/2014, 04:20
... common aetiological agent of GUD [5] Studies of HSV-2 seroprevalence have found high rates in African-Americans [6] and in African populations in Uganda, Zimbabwe, Tanzania, Central African Republic, ... are appropriate in asymptomatic cases, when viral culture and PCR assays are largely negative [15] Several commercially available HSV-type specific serological assays are available, but a test ... the addition of M13 primer sequences [HSV-M13 forward 5'-TGTAAAACGACGGCCAGTAGCCTGTAC- http://www.virologyj.com/content/2/1/61 CCCAGCAT-3'; HSV-M13 reverse 5'-CAGGAAACAGCTATGACCTGGGCCTTCACGAAGA-3']...
- 10
- 440
- 0
báo cáo hóa học:"Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" potx
Ngày tải lên :
20/06/2014, 04:20
... determination of JC viral load A – C: Analysis of HA and quantitative real-time PCR data employed for the determination of JC viral load JCV (Mad1), propagated in Dr Walker's laboratory (I) or propagated ... between real-time PCR and HA assays for the determination of JC viral load JCV(Mad1) was propagated in primary human fetal glial (PHFG) cells and purified in Dr Duard Walker's laboratory (I) ... agglutination and traditionally, hemagglutination (HA) and HA inhibition (HAI) assays have been employed for quantitation of JCV [8-14] However, the HA assay is poorly sensitive and the in vitro quantitation...
- 5
- 327
- 0
Báo cáo khoa học: "A multiplex real-time PCR for differential detection and quantification of Salmonella spp., Salmonella enterica serovar Typhimurium and Enteritidis in meats" pps
Ngày tải lên :
07/08/2014, 23:22
... aggccttcgggttgtaaagt gttagccggtgcttcttctg FAM-aaccgcagcaattgacgttaccc-BHQ 1a tgcagaaaattgatgctgct ttgcccaggttggtaatagc JOE-acctgggtgcggtacagaaccgt-BHQ 1a ggtaaaggggcttcggtatc tattggctccctgaatacgc Cy5-tggtggtgtagccactgtcccgt-BHQ 1a ... Although the multiplex real-time PCR assay was demonstrated as an applicable assay in artificially inoculated meats, it needs further research for natural meat cases and other types of food and ... Fey A, Eichler S, Flavier S, Christen R, Höfle MG, Guzmán CA Establishment of a real-time PCR-based approach for accurate quantification of bacterial RNA targets in water, using Salmonella as a...
- 9
- 410
- 0
Báo cáo khoa học: "Real time PCR analyses of expression of E-cadherin, alpha-, beta- and gamma-catenin in human breast cancer for predicting clinical outcome" pps
Ngày tải lên :
09/08/2014, 07:21
... actgaacctgaccgtacacatgccctcatctaatgtct Primers for human E-Cadherin ECADF8 cagaaagttttccaccaaag ECADZR actgaacctgaccgtacaaaatgtgagcaattctgctt Primers for human γ-catenin gCatF1 aacaagaacaaccccaagtt gCatZr actgaacctgaccgtacatagttacgcatgatctgcac ... α-catenin ACATENINF1 ACATENINZR caacccttgtaaacaccaat actgaacctgaccgtacaccttctccaagaaattctca Primers for human β-catenin BCATENINF8 agggattttctcagtccttc BCATENINZF actgaacctgaccgtacacatgccctcatctaatgtct ... the mean background reading Statistical analysis The data obtained was analysed using the MINITAB 13.32 (Minitab Inc State College, PA, USA) programme Statistical significance was calculated using...
- 6
- 303
- 0
Báo cáo y học: " “pp65 antigenemia and real time polymerase chain reaction (PCR) based-study to determine the prevalence of human cytomegalovirus (HCMV) in kidney donors and recipients with follow-up studies.”" pptx
Ngày tải lên :
12/08/2014, 02:20
... Christmas SE, Halliday D, Lawton N, Wang H, Abdalla I, Masters J, Hassan RL, Hart IJ, Khan N, Smith J, Hammad A, Bakran A: Cytomegalovirus-specific CD8+ T cells not develop in all renal transplant ... renal transplant recipients who participated in the study Antigenemia assay The pp65 antigenemia assay was carried out on smears containing × 10 leucocytes prepared from ml of EDTA anticoagulated ... Surveillance of cytomegalovirus after solid- organ transplantation: comparison of pp65 antigenemia assay with a quantitative DNA hybridization assay J Clin Microbiol 1997, 35:3303-3304 Cariani EP,...
- 7
- 399
- 0
Báo cáo y học: " Detection of porcine parvovirus using a taqman-based real-time pcr with primers and probe designed for the NS1 gene" doc
Ngày tải lên :
12/08/2014, 02:20
... primers and probe were: NS1-FP (forward primer): 5’-GAAGACTGGATGATGACAGATCCA-3’, NS1-RP (reverse primer): 5’-TGCTGTTTTTGTTCT TGCTAGAGTAA-3’ NS1-P (probe): FAM-AATGATGGCTCAAACCGGAGGAGA-BHQ1 The ... indicate the number of samples that generated similar data for both assays b,d indicate the number of samples that generated different data for the assays The TaqMan real-time PCR assay will be useful ... was labeled with 6carboxyfluorescein (FAM) at the 5’-end and with BHQ1 at the 3’-end Preparation of standard plasmid DNA PCR amplification of the NS1 gene was carried out in a reaction mix of...
- 4
- 587
- 0
báo cáo khoa học: " Selection of reference genes for quantitative real-time PCR expression studies in the apomictic and sexual grass Brachiaria brizantha" ppt
Ngày tải lên :
12/08/2014, 03:20
... 5'CAGCAAGGGAGGAACCAG TA3' 5'TAGCGCAAGACCATCAAC AA3' 130 bp 5'ATGAAGGCGATGAAGGAG AA3' 5'GTACGCAATGGAATGGAA CC3' 112 bp 5'GGTCTTGCTCTCCATCTG CT3' 5'CGGGCTGTCGTCTCATAC TT3' 114 bp 5'ACCAGCACAAATCAAAGG A3 ' 5'GCCAAAGTATGAGACGAC ... 5'TAAGGTGGGGCTTGTTTT TG3' 5'ACAGCAGCACATACCACA GG3' 164 bp 5'TGAATCTAGTCCATCCGC TTG3' 5'TCATCAGGCAGGGAAGCT A3 ' 124 bp 5'GGGCATTTTGGGTTATGT TG3' 5'TCCCCACTCGTTGTCATA CC3' 146 bp 5'CAGCAAGGGAGGAACCAG ... in Brazil are B brizantha cv Marandu and B decumbens cv Basilisk [1] They show qualities of forage grass, good adaptability to cerrado areas (dry-tropical savanna, Brazil), and are cultivated...
- 10
- 267
- 0
báo cáo khoa học: " Validation of reference genes for quantitative real-time PCR during leaf and flower development in Petunia hybrida" pot
Ngày tải lên :
12/08/2014, 03:21
... CCTGGTCAAATTGGAAACGG/ CAGATCGCCTGTCAATCTTGG 103 1.62 ± 0.08 AACAACTCACTCCTACACCGG/ GGTAGCACTAGAGACACAGCCTT CAGGCAGGTTAAGGCAAAGC/ CTAGCAAGGTACAGAAACGGC AAGCTCCCACCTGTCTGGAAA/ AACAGATTGCCGGAAGCCA CTTACGACGAGTTCAGATGCC/ ... an optimal normalization factor that merges data from all of them Finally, NormFinder fits data to a mathematical model, which allows comparison of intra- and intergroup variation and calculation ... CTTACGACGAGTTCAGATGCC/ TAAGTCCTCAACACGCATGC TGGAAACTCAACCTCCATCCA/ TTTCGTCCATTCCTTCACCTG 135 1.83 ± 0.09 114 1.70 ± 0.04 103 1.71 ± 0.07 135 1.61 ± 0.12 114 1.61 ± 0.05 TGGAGGATGGAAGGACTTTGG/ CAGGACGACAACAAGCAACAG...
- 11
- 330
- 0
Báo cáo y học: " Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR" pot
Ngày tải lên :
12/08/2014, 04:20
... GCATAATCAATTATTTGTTACTGTGGTAGATACCACT 400 nM HP18L1R GCTATACTGCTTAAATTTGGTAGCATCATATTGC 400 nM HPV18L1probe HEX-AACAATATGTGCTTCTACACAGTCTCCTGT-BHQ2 100 nM HPVE1F1 ANANGCTGTGCAKGNNCTAAAACGAAG ... AGTTTCCACTTCAGTATTGCCATA 300 nM HAPBF TGAAGGTGGAGGACATTCCTCTA 400 nM HAPBR CTGGAATTGCGATTTCTGGTAA 400 nM HAPBprobe Cyan500-CGAGAATCACCCTGCCAGACTTCCGT-BBQ 100 nM Sybr Green Real Time PCR TaqMan ... 962046 anal virapap swab 11 + 11 950450 anal virapap swab 16 + 16 972696 anal virapap swab 33‡ + - 971380 anal virapap swab 35‡ + - 000699 anal virapap swab 40* + - 061675 anal virapap swab 45§...
- 17
- 413
- 0
Báo cáo khoa học: " Establishment of one-step SYBR green-based real time-PCR assay for rapid detection and quantification of chikungunya virus infection" pps
Ngày tải lên :
12/08/2014, 04:21
... sequences are available in GenBank (GenBank accession no: AF490259 of Ross reference strain, EU703762.1 of Malaysia strain, EF027140.1 of Indian strain, AM258995.1 of Reunion strain and EF452494.1 of ... inoculation and stored at -80°C Viral RNA was extracted (Qiamp viral RNA kit; Qiagen, Germany) from the virus supernatant, titrated with plaque forming assays [12], and serial diluted accordingly ... Savini H, Parola P: Chikungunya: a paradigm of emergence and globalization of vector-borne diseases Med Clin North Am 2008, 92:1323-1343 McGill PE: Viral infections: alpha-viral arthropathy Baillieres...
- 7
- 262
- 0
Báo cáo khoa học: "Detection of anatid herpesvirus 1 gC gene by TaqMan™ fluorescent quantitative real-time PCR with specific primers and probe" pps
Ngày tải lên :
12/08/2014, 04:21
... detection Name Type Sequences (5’ to 3’) Length (nt) Amplicon size (bp) 1296 P1 Forward CGGAATTCCAAAACGCCGCACAGATGAC 28 P2 Reverse CCCTCGAGGTATTCAAATAATATTGTCTGC 30 P3 P4 Forward Reverse GAAGGACGGAATGGTGGAAG ... GAAGGACGGAATGGTGGAAG AGCGGGTAACGAGATCTAATATTGA 20 25 P Probe FAM-CCAATGCATCGATCATCCCGGAA-TAMRA 23 The underlined sequences of P1 and P2 are EcoR I and Xho I restriction sites respectively 78 Zou et al Virology ... related AHV-1 and gC DNA vaccine research Methods Viruses and bacteria AHV-1 Cha strain and Escherichia coli JM109 were obtained from Key Laboratory of Animal Diseases and Human Health of Sichuan...
- 10
- 293
- 0