use of indefinite and partitive articles with a negative expression
Báo cáo y học: "Marked disability and high use of nonsteroidal antiinflammatory drugs associated with knee osteoarthritis in rural China: a cross-sectional population-based survey" ppt
Ngày tải lên :
12/08/2014, 15:22
... presence of back pain, and years of education Among those with knee pain, we evaluated the association of radiographic knee OA and use of health services and medications by using the multivariable ... 31:2439-2443 Chaiamnuay P, Darmawan J, Muirden KD, Assawatanabodee P: Epidemiology of rheumatic disease in rural Thailand: a WHO-ILAR COPCORD study J Rheumatol 1998, 25:1382-1387 Chopra A, Saluja M, Patil ... health care resources and preventive strategies The aim of this study was to describe and compare levels of pain, physical disability, and use of medications and health services among people with...
- 7
- 356
- 0
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
Ngày tải lên :
19/02/2014, 05:20
... dried and autoradiographed using Phosphorimager Storm Band intensities on the gels were quantified with image-quant software Average values and standard errors shown in the graphs were calculated ... connected with the facts that modification of particular sites in the genome of living cells is naturally stochastic on the one hand, and influenced by the actual structural and functional state of the ... spectrum of cisplatin adducts identified in globally modified chromosomal DNA comprises about 50% of 1,2-GG IACs, 25% of 1,2-AG IACs, 10% of 1,3-GNG IACs and interstrand crosslinks, and another 2–3% of...
- 14
- 597
- 0
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx
Ngày tải lên :
22/02/2014, 07:20
... Histone modifications such as acetylation and phosphorylation play important roles in the regulation of chromatin structure In particular acetylation of the N-terminal tails of histones are thought ... important It implies that the steady-state intracellular concentration of gd102NLS at genomic and at episomal targets must be in the same range The centers of the loxP site and of the site I of ... shown that these basic properties of chromatin are not significantly altered by the transcriptional status of DNA In contrast to loxP sites and sites I of res, the reactivity of episomal and genomic...
- 7
- 472
- 0
Traffic-related air pollution associated with prevalence of asthma and COPD/chronic bronchitis. A cross-sectional study in Southern Sweden pdf
Ngày tải lên :
06/03/2014, 19:20
... drafts AA: Wrote part of the manuscript and made major revisions of drafts All authors read and approved the final manuscript Acknowledgements Overall, our results show that traffic-related air ... levels An Italian study reported an association between symptom exaggeration of adult asthma and NO2 exposure levels [12], and the Swiss SAPALDIA study observed an increase of asthma-related symptoms, ... background Descriptive data of regional air pollution at a monitoring station in a rural area Annual mean concentrations of traffic-related pollutants measured at Vavihill 1985–2006 Data source: IVL Swedish...
- 15
- 374
- 1
formation of zno thinfilms consisting of nano-prisms and nano-rods with a high
Ngày tải lên :
06/05/2014, 13:23
... positively charged Zn (0001) and negatively charged O (000l) surfaces, resulting in a normal dipole moment and spontaneous polarization along the c-axis as well as a variance in surface energy ... Na3-citrate and Al(NO3)$ 6H2O as surfactant chemicals in the hydrothermal synthesis at 60 C Experimental details Zinc nitrate hexahydrate (Zn(NO3)$6H2O) was used to grow ZnO crystals, and aluminum ... indication of an interfacial reaction or any formation of amorphous compounds The SAED pattern showed that the film was c-axis oriented in the substrate normal direction with a slight out -of- plane...
- 5
- 274
- 0
báo cáo hóa học: " Use of alcohol and drugs by Norwegian employees: a pilot study using questionnaires and analysis of oral fluid" doc
Ngày tải lên :
20/06/2014, 00:20
... clonazepam 0.36 7-aminoflunitrazepam Degradation product and metabolite of flunitrazepam 0.07 7-aminonitrazepam Degradation product and metabolite of nitrazepam 0.31 oral fluid and possible explanations ... been taken A combination of methamphetamine and diazepam was found in two samples In those cases, amphetamine was also detected as a metabolite of methamphetamine The combination of methamphetamine ... of alcohol and drugs in the Norwegian workplace, and to examine some of the consequences that alcohol and drug use may have for sick leave, in-efficiency and hang-over at work An additional aim...
- 8
- 418
- 0
Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed - Use of Industrial and Mixed Feed by Livestock Producers in Vietnam " doc
Ngày tải lên :
21/06/2014, 05:20
... Departments of Livestock Production and Animal Health, Ministry of Agriculture and Rural Development and provincial Departments, relevant staff of the National Institutes of Animal Husbandry and ... of Agriculture, and relevant Departments of the Ministry of Agriculture and Rural Development and provincial Departments of Agriculture and Rural Development, Vietnam Association of Small and ... animal husbandry and aquaculture The decision prohibits the import, production and use of materials and animal feed contaminated with melamine The acceptable level of melamine is less than 2.5mg/kg...
- 27
- 536
- 0
Theory of Interest and Life Contingencies With Pension Applications A Problem Solving Approach by Michael M_1 potx
Ngày tải lên :
21/06/2014, 08:20
... insurance and of the numeraire are All individuals purchase the same amount of annuities and life insurance and, for a given income, optimum utility increases with life expectancy, z(α) Let pa and ... (14.10) For general analyses of pooling equilibria see, for example, Laffont and Martimort (2002) and Salanie (1997) As before, we assume that only linear price policies are feasible August 18, 2007 ... purchase the bundle and also purchase X1 and X2 in stand-alone markets Typically, there are multiple pooling equilibria The above example demonstrates that in some equilibria we may find bundling of...
- 19
- 569
- 0
Theory of Interest and Life Contingencies With Pension Applications A Problem Solving Approach by Michael M_4 ppt
Ngày tải lên :
21/06/2014, 08:20
... annuities As figures 9.1 (a) and (b) clearly display, at all ages annuitants, whether males or females, have higher survival rates than the population average rates (table 9A. 1 in the appendix provides ... underlying data) Adverse selection seems somewhat smaller among females, perhaps because of the smaller variance in female survival rates across different occupations and educational groups Adverse ... survival rates for males and females born in 1935, distinguishing between the overall population average rates and the rates applicable to annuitants, that is, those who purchase private annuities...
- 19
- 589
- 0
Theory of Interest and Life Contingencies With Pension Applications A Problem Solving Approach by Michael M_5 pptx
Ngày tải lên :
21/06/2014, 08:20
... medical plan that an individual has), then competition could attain the first best With many suppliers of medical care and the multitude of factors affecting survival that are subject to individuals’ ... the market and distributes the market returns annually among the surviving members of each age cohort 5.4 Partial Annuitization: No Short-Term Annuity Market Many practical questions about annuitization ... survival probabilities at all ages A series of studies (Hurd, McFadden, and Gan, 2003; Hurd, McFadden, and Merrill, 1999; Hurd, Smith, and Zissimopoulos, 2002; Hurd and McGarry, 1993; Manski,...
- 19
- 510
- 1
Theory of Interest and Life Contingencies With Pension Applications A Problem Solving Approach by Michael M_7 pot
Ngày tải lên :
21/06/2014, 08:20
... portfolio rules and the flow of expected revenues and outlays on account of annuities There is an extensive financial literature that deals with this and related issues Analysis of this link and the functioning ... survival Most loans to individuals are, at least partially, backed by nonannuitized assets (collateral), but some can be regarded as negative annuities For example, credit card debts have a high ... retirement against longevity risks In the United States today, a 65-year-old man and woman can expect to live to age 81 and 85, respectively, and there is a substantial variation in survival probabilities...
- 19
- 941
- 0
Theory of Interest and Life Contingencies With Pension Applications A Problem Solving Approach by Michael M_9 doc
Ngày tải lên :
21/06/2014, 08:20
... effects and, 3–4; insurance, 82 (see also insurance); low returns and, 35; medical prices and, 54; no late transactions and, 138–40; partial annuitization and, 33–34; replacement rates and, 2–3; ... equilibrium and, 56–58, 83–84; individual savings and, 98; life cycle model and, 21–26; longevity increase and, 30–32, 44; long-term annuities and, 63–66; moral hazard and, 51–55; no late transactions and, ... worth of, 10; moral hazard and, 51–55, 79–80; no-arbitrage condition and, 5, 24–25, 60–62, 70–71; optimum taxation of, 125–28; options and, xv, 9; partial annuitization and, 33–35; payout terms and, ...
- 11
- 484
- 0
Báo cáo hóa học: " Non operative management of liver and spleen traumatic injuries: a giant with clay feet" pptx
Ngày tải lên :
21/06/2014, 19:20
... years a liberal and more aggressive use of angiography has often been observed and is associated with higher rates of NOM (80%) and lower rates of Page of failure (2-5%); nonetheless several ... JW: American Association for the Surgery of Trauma Organ Injury Scale I: spleen, liver, and kidney, validation based on the National Trauma Data Bank J Am Coll Surg 2008, 207(5):646-55 Watson GA, ... (Prof A D Pinna) S Orsola Malpighi University Hospital Via Massarenti, 40138, Bologna, Italy 5Charlotte Maxeke Johannesburg Academic Hospital, Department of Surgery, University of Witwatersand...
- 4
- 311
- 0
Báo cáo khoa học: " Protection of chickens from Newcastle disease with a recombinant baculovirus subunit vaccine expressing the fusion and hemagglutinin- neuraminidase proteins" pdf
Ngày tải lên :
07/08/2014, 20:24
... H, Tawara H, Nakazawa H, Sumida M, Matsubara F, Aoyama S, Iritani Y, Hayashi Y, Kamogawa K Expression of the Newcastle disease virus (NDV) fusion glycoprotein and vaccination against NDV challenge ... Gene amplified size (bp) 1,701 1,795 1,719 1,779 Primer sequence 5' TCCAGGTGCAAGATGGGCTCC 3' 5' AGGGAAACCTTCGTTCCTCAT 3' 5' TCAATCATGGACCGCGCCGTT 3' 5' CGCAGAAGATAGGTGATACAA 3' 5' ACATTCAGGACACAATATGGG ... fusion and hemagglutininNeuraminidase antigens Avian Dis 1996, 40, 770-777 Iritani Y, Aoyama S, Takigami S, Hayashi Y, Ogawa R, Yanagida N, Saeki S, Kamogawa K Antibody response to Newcastle disease...
- 8
- 315
- 0
Báo cáo y học: "vitamin B12 status in patients of Turkish and Dutch descent with depression: a comparative cross-sectional study" pot
Ngày tải lên :
08/08/2014, 23:21
... normal distribution were tested with the parametric Student t test Interval and ratio data without a normal distribution and data of an ordinal measuring level was tested using the non-paramedical ... Statistical analysis The patient features were analysed via descriptive statistics The differences between the various subgroups at the various measuring moments and the interval and ratio data with a ... purposes) Annals of General Psychiatry 2009, 8:18 http://www.annals-general-psychiatry.com/content/8/1/18 Table 1: Demographic information and clinical data on patients Demographic or clinical data Patients...
- 5
- 674
- 0
Báo cáo y học: "Prevalence of alexithymia and its association with anxiety and depression in a sample of Greek chronic obstructive pulmonary disease (COPD) outpatients" pptx
Ngày tải lên :
08/08/2014, 23:21
... (a) anxiety caused by a specific condition (state subscale) and (b) anxiety as a more permanent characteristic of personality (trait subscale) The Greek validation of the trait subscale was used ... psychological measures, collected data, gave suggestions for the concept of alexithymia and helped draft the paper; GM and AK helped draft the paper; II carried out the statistical analysis and helped ... helped draft the paper; NS and AV supervised the study; NT carried out Page of the statistical analysis, helped draft the paper and supervised the study All authors read and approved the final manuscript...
- 7
- 436
- 0
Báo cáo khoa học: " Long term outcome of adolescent and adult patients with pineal parenchymal tumors treated with fractionated radiotherapy between 1982 and 2003 - a single institution’s experience" pot
Ngày tải lên :
09/08/2014, 09:20
... Pineal parenchymal tumors: a correlation of histological features with prognosis in 66 cases Brain Pathol 2000, 10(1):49-60, Review Anan M, Ishii K, Nakamura T, Yamashita M, Katayama S, Sainoo ... pineoblastoma, of which were recurrences 10 patients were female, among them with a pineocytoma and the patient Page of with the PPTID The median age at time of radiation treatment was 40 years ... craniospinal tract was treated Irradiation of the whole brain or the craniospinal tract was performed with a median dose of 35 Gy (30-40 Gy) The craniospinal axis was also treated in both patients with...
- 7
- 365
- 0
Báo cáo y học: " Fat distribution and longitudinal anthropometric changes in HIV-infected men with and without clinical evidence of lipodystrophy and HIV-uninfected controls: A substudy of the Multicenter AIDS Cohort Study" potx
Ngày tải lên :
10/08/2014, 05:21
... drafted the manuscript and directed the statistical analysis XX and MJ performed the statistical analysis and helped draft the manuscript JS helped draft the manuscript and assisted with database ... mellitus and cardiovascular disease[24,25] Clinicians should be aware that some HIV-infected patients, even at a relatively normal BMI, may be at increased risk of adverse metabolic and cardiovascular ... and race, 2) MACS site, race and BMI, and 3) MACS site, race and lean body mass VAT was similar among the three groups when adjusted for MACS center and race only After additional adjustment for...
- 8
- 407
- 0
Báo cáo y học: "A comparison of the MOS-HIV and SF-12v2 for measuring health-related quality of life of men and women living with HIV/AIDS" pptx
Ngày tải lên :
10/08/2014, 05:21
... Ion et al AIDS Research and Therapy 2011, 8:5 http://www.aidsrestherapy.com/content/8/1/5 Page of Table Mean, Standard Deviation, Median and Min-Max Values for Components/Domains of MOS-HIV and ... coordination of the study, assisted with the statistical analysis and helped to draft the manuscript EP assisted with development and interpretation of the statistical analysis and helped to draft ... Gonzalez A, Pedrol E, Gatell JM, Azuaje C, Llibre JM, Aranda M, Barrufet P, Martinez-Lacasa J, Podzamczer D and the COMBINE Study Team: Health-related quality of life in HIVinfected naive patients...
- 9
- 449
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2