use of a surrogate marker in the approval of new formulations

Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx

Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx

Ngày tải lên : 11/08/2014, 21:22
... control of the subclavian artery above the clavicle (Fig 3A) Simultaneous exposure of the brachial artery in the antecubital fossa was performed and a size Fogarty embolectomy catheter passed distally ... limb ischaemia [4,5,9] Pseudoaneurysm formation of the axillary artery is rare following blunt and penetrating trauma to the shoulder, often presenting late as a pulsatile mass rather than acute ... a Javid™ shunt, which allowed safe internal fixation of the fracture before bypass grafting The insertion of the Javid™ shunt served to confirm the viability of the limb and adequacy of distal...
  • 4
  • 342
  • 0
Focus - A simplicity manifesto in the Age of Distraction

Focus - A simplicity manifesto in the Age of Distraction

Ngày tải lên : 05/01/2014, 15:25
... what are you afraid of? Then shine a light on these fears with actual facts — what harm has actually been caused so far? Try to a short test — an hour, a day, a few days, a week — and see what ... inspiration in what others have done, you get ideas, you gather the raw materials for creating But consuming and communicating aren’t creating They aid creating, they lay the groundwork, but at some point ... What blogs? What news? What other reading or watching or listening? What can you cut out? Can you cut half of the things you read and watch? More? Try eliminating at least one thing each day: a...
  • 121
  • 552
  • 1
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

Ngày tải lên : 21/02/2014, 03:20
... RESULTS The single point mutation aE210K was introduced into the atp2 operon of Rb capsulatus, containing the F0 genes, cloned in an E coli strain The mutated operon was then transferred into a broad-host-range ... When the assay contained valinomycin, the data reported in Fig 1B were obtained In this case, the ATP yield of both wild-type and mutant as a function of illumination time presented a lag phase ... appreciated by taking the derivative of the fitting functions of the mutant and wild-type data and plotting their ratio, as in Fig 1C This derivative represents the rate of ATP synthesis at each...
  • 9
  • 580
  • 0
Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc

Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc

Ngày tải lên : 21/02/2014, 08:20
... had acquired at Metz In the meantime we taught him, at the same place, the manual of arms and Infantry tactics which had been introduced into the army after he was graduated at the Military Academy ... necessary for the arrival of the captain commander in this city" Owing to casualties of service, I had almost continually commanded the company, its train, and the general engineer train of the army for ... several days, working on a mule path "cut-off" from the main road "January 14th The mule path was infamous No wagon had ever traveled that road the rancheros have a tradition of a bull cart that,...
  • 48
  • 504
  • 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

Ngày tải lên : 07/03/2014, 12:20
... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢...
  • 16
  • 397
  • 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Ngày tải lên : 08/03/2014, 09:20
... obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial ... molecules may still rely on the SecB pathway, because of overloading of the SRP pathway The re-routing of (G-10L)prePhoE to the Sec translocon via the SRP instead of the SecB pathway could be explained ... [13] Quantification of the data indicated that the cross-linking efficiency of the mutant nascent chains was somewhat reduced (Fig 3B) In conclusion, our results show an increased affinity of the G-10C...
  • 8
  • 546
  • 0
Prevalence of presumed ocular tuberculosis among pulmonary tuberculosis patients in a tertiary hospital in the Philippines pdf

Prevalence of presumed ocular tuberculosis among pulmonary tuberculosis patients in a tertiary hospital in the Philippines pdf

Ngày tải lên : 15/03/2014, 03:20
... cases It has been estimated to be under 1% in the USA, 4% in China, 6% in Italy, 7% in Japan, and 16% in Saudi Arabia [10] A Southeast Asian neighbor, Thailand, reported a 2.2% systemic TB involvement ... study in 2002 [8] Biswas and Badrinath examined 2,010 eyes of pulmonary TB patients and found a 1.39% ocular involvement [9] Other studies include data about ocular TB as a fraction of uveitis cases ... Patients and had combined findings in the anterior and posterior segments of the eye; VAi, best-corrected visual acuity (BCVA) prior to ATT; VAf, BCVA after weeks of ATT; GAU, granulomatous anterior...
  • 4
  • 517
  • 0
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

Ngày tải lên : 16/03/2014, 04:20
... that the PX domain of p47phox binds intramolecularly to the SH3 domain in the same protein, and that this intramolecular interaction suppresses the lipid-binding activity of the PX domain in the ... revealed that the GT ⁄ AG rule was maintained in all cases (data not shown) The deduced protein primary structure of mouse and human fad49 The ORF of fad49 encodes a putative protein of 910 amino acids ... domains, suggesting that the PX domain could bind to an SH3 domain of FAD49 To test whether the PX domain could interact with an SH3 domain in FAD49, we performed in vitro binding assays using...
  • 13
  • 385
  • 0
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf

Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf

Ngày tải lên : 16/03/2014, 16:20
... substrates The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the COOH group has to be positioned as in NIPAB ... protein chain, acting as a flap, first opening and then closing the groove [45] The catalytic reaction presumably occurs when the ionized carboxyl group of PG approaches the guanidine side chain of ... several polar amino acid residues This part of the enzyme can be considered as its S1¢ binding subsite Substrate binding induces conformational changes involving the ArgA145PheA146 fragment of the...
  • 8
  • 438
  • 0
How Teens Use Media - A Nielsen report on the myths and realities of teen media trends pdf

How Teens Use Media - A Nielsen report on the myths and realities of teen media trends pdf

Ngày tải lên : 23/03/2014, 03:20
... know a newspaper if the paperboy hit them in the face Reality: More than a quarter of U.S teens say they read a daily newspaper and more than a third say they read on Sunday As some newspapers ... respectively The typical U.S teen used a video game console an average of 25 minutes per day in 2008, for gaming or other multimedia uses—an average that has increased over the past five years as a new ... Mature by the ESRB At its peak, 61% of active gamers said they had a definite interest in Halo The other Mature rated game in the top five was Grand Theft Auto IV which, with a 37% “definite interest”...
  • 17
  • 452
  • 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Ngày tải lên : 23/03/2014, 15:21
... proteins in the algae of red lineage which contain Haptophyta, diatoms and brown algae and are characterized by chlorophyll a ⁄ c The psbP gene is present in some of the algae in the red lineage ... shown) The behavior of this band in the diatom is thus similar to that of the PsbPlike protein in cyanobacteria [3,12] The fact that C gracilis, P gyrans, L japonica and U pinnatifida contained bands ... suggesting the absence of these proteins in the green algal and higher plant PSII Plant species having cyanobacterial-type extrinsic proteins Glaucophyta as represented by Cyanophora paradoxa, are a...
  • 11
  • 501
  • 0
Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

Ngày tải lên : 23/03/2014, 20:22
... 8.5–11.0 Determination of the pKa value was performed by a curve fitting with the calculated curves of the fraction of alkaline form vs pH for given pKa values in the Henderson–Hasselbalch equation EPR ... was completed by monitoring the maximum loss of the Soret band (A4 02) and the formation of biliverdin (A7 30) In the experiments using NADPHreductase, the 14 equivalent of NADPH was added to the ... -), and 9.3 (– –), based on the Henderson–Hasselbalch equation The heavy dots are the fractions estimated from the experimentally obtained absorbance at 418 nm that is normalized against the value...
  • 12
  • 459
  • 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

Ngày tải lên : 28/03/2014, 23:20
... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... vinifera ax T84 A thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a b an TS ali th A A ... B1 A th aliana CaU GT1 C ro seu UG s T7 1C UG 1A T7 th UG alia 1D T8 na UG A 8A T7 th 2E ali A 2A an th a th al ia ali na an a thalia 1A th alia na na 6B1 A UG T76 C UGT7 A1 CAO69089 V vinifera...
  • 11
  • 661
  • 0
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf

Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf

Ngày tải lên : 29/03/2014, 00:20
... presence of diadenosine pentaphosphate, a blocker of adenylate kinase) was measured by exploiting the differential affinity of ADP and ATP for Mg2+ The rate of ATP appearance in the medium following addition ... species, including the deletions of four amino acids Finally, we show that the ADP–ATP exchange rate mediated by ANT expressed in mitochondria of A franciscana and Ca2+ uptake capacity are insensitive ... PTP in embryos of A franciscana marks a cornerstone in our understanding of the long-term tolerance, extending for years, to anoxia and diapause, conditions that are invariably accompanied by large...
  • 15
  • 505
  • 0
Báo cáo khoa học: Deviation of the neurosporaxanthin pathway towards b-carotene biosynthesis in Fusarium fujikuroi by a point mutation in the phytoene desaturase gene ppt

Báo cáo khoa học: Deviation of the neurosporaxanthin pathway towards b-carotene biosynthesis in Fusarium fujikuroi by a point mutation in the phytoene desaturase gene ppt

Ngày tải lên : 30/03/2014, 01:20
... upstream of the start codon and the first 957 bp of the carB coding sequence, and 5¢CGTTGAGGCACTGGTTAACG-3¢ and 5¢-CGAGAAT CATGGACATAGAC-3¢, covering the last coding 1048 and 88 bp downstream of the ... were isolated after transformation of the SF1 strain with a plasmid carrying carB36 In five of them, Southern blot analyses showed the incorporation of a single copy of the plasmid at the carB locus ... Carotenoid and retinal biosynthesis in Fusarium fujikuroi The pathway involves CarRA, CarB, the cleaving oxygenases CarX and CarT, and a postulated dehydrogenase CarD Desaturations introduced by the CarB...
  • 16
  • 440
  • 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Ngày tải lên : 30/03/2014, 04:20
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... splice variants (Pfu Ultra system; Stratagene) Upper primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, ... Supplementary material The following supplementary material is available online: Fig S1 Comparison of human and Rhesus monkey PKA Cb amino acid sequence This material is available as part of the online...
  • 13
  • 344
  • 0
Báo cáo khoa học: Light regulation of CaS, a novel phosphoprotein in the thylakoid membrane of Arabidopsis thaliana doc

Báo cáo khoa học: Light regulation of CaS, a novel phosphoprotein in the thylakoid membrane of Arabidopsis thaliana doc

Ngày tải lên : 30/03/2014, 04:20
... 5¢-AAATGGCAACGAAGTCTTCAC-3¢ and 5¢-CAGTCGGAGCTAGGAAGGAA-3¢ Isolation of plasma membrane, intact chloroplasts, stroma and thylakoids The plasma membrane fraction of Arabidopsis was isolated as ... GGCTTAAUATGGCTATGGCGGAAATGG CAACGA) and nt115 (reverse: GGTTTAAUTAAGGATC CTTAATTAAGCCTCAGCGGGTCGGAGCTAGGAAG GAACTT), where the underlined sequence was included for regeneration of a USER cloning cassette The PCR ... is a crucial component of the protein phosphorylation cascade involved in CaS phosphorylation Characterization of the CaS mutant lines The mutant Arabidopsis lines with T-DNA insertion in the intron...
  • 11
  • 446
  • 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot

Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot

Ngày tải lên : 30/03/2014, 15:20
... substrate Therefore, the metal ion has a catalytic rather than just a substrate binding role Possible roles of the cation include the activation of water for the hydration reaction and ⁄ or the stabilization ... Ontario, Canada) or New England Biolabs (Pickering, Ontario, Canada) All other chemicals were of analytical grade and were obtained from Sigma-Aldrich and Fisher Scientific (Nepean, Ontario, Canada) ... pathway [5] The binding of divalent cations by the decarboxylase precludes metal binding studies of the hydratase in that complex In this study, BphH, the hydratase in the PCBs degradation pathway...
  • 9
  • 461
  • 0