use of a computer in laboratory analysis
báo cáo hóa học: " A pilot study evaluating use of a computer-assisted neurorehabilitation platform for upper-extremity stroke assessment" pptx
... (e.g reaching, tracking, and coping with instability) that may relate to ADLs A suite of kinematic measures were developed to examine various movement features in each type of goal-directed tasks ... The Range of Capacity (ROC) toolbox can be used to assess the user's initial and final capability ROM when using an input device and optionally used to map between the input device workspace range ... study, involving use of the UniTherapy software interfaced with a conventional force-reflecting joystick, validated the viability of using the combination of goaldirected tasks with associated kinematic...
- 15
- 361
- 0
báo cáo khoa học: " A radiographic analysis of tooth morphology following the use of a novel cyclical force device in orthodontics Chung H Kau" pps
... Image manipulation was carried out using the manufacturer’s software, Galaxis To increase the accuracy of the assessment, all three planes (sagittal, axial, and coronal) were utilized CBCT images ... resorption of permanent teeth is an inflammation caused by varying factors, including injury to the root surface followed by dental trauma, surgical procedures, non-vital teeth bleaching, and mechanical ... the manufacturer It has a scan time of 14 s and captures the maxilla-mandibular region in a 210° rotation within a radiation-detector configuration The field of view is a spherical volume of 15...
- 5
- 352
- 0
Báo cáo khoa học: " The use of prophylactic fluconazole in immunocompetent high-risk surgical patients: a meta-analysis." doc
... Critical Care Vol No Ho et al Figure Flow chart showing study inclusion and exclusion in this meta -analysis meta -analysis renal failure, total parenteral nutrition, gastrointestinal perforation, and ... The candidaemia rate of 4.5% in the placebo arm of this metaanalysis is consistent with the estimated risk of candidaemia in patients with at least one risk factor for candidaemia The risk factors ... pharmacoeconomic or cost-effectiveness analysis was not performed in the studies included in this meta -analysis Based on the baseline risk of candidaemia of 4.5% in the placebo arm of this meta -analysis, ...
- 8
- 226
- 0
A STUDY ON THE USE OF PEER TEACHING IN ESP CLASSES AT THE COLLEGE OF SCIENCE, VIETNAM NATIONAL UNIVERSITY HANOI
... individual or group learning, and learning goals of individuals and the agendas set by others We also need to consider where peer teaching fits into the scheme of teaching and learning within a particular ... has led teachers to think about more learnercentred ways of presenting their courses Interest in peer teaching in particular has been increasing in recent years for a number of reasons At least ... is to examine the impact of ‘Peer-teaching’ on ESP teaching and learning quality, the collected data of the study was analyzed both quantitatively and qualitatively according to two facets: (1)...
- 40
- 903
- 3
Báo cáo khoa học: "USE OF HERRISTIC KNOWLEDGE IN CHINNESE LANGUAGE ANALYSIS" ppt
... words are used to forecast partial syntactic structure of sentences before global analysis, thus restricting the path through the search space in syntactic analysis Comparative processing using ... characters) We use 200 characteristic words and have written the rules by I01 automata for ~ them As a preliminary evaluation, we tested the system (partly by hand) against 120 sentences taken ... the kind of fragment Accordingly, a longer fragment gets higher priority in some cases, lower priority in other cases [i] Yiming Yang: A Study of a System for Analyzing Chinese Sentence, masters...
- 4
- 385
- 0
Use of Alternative Fuels in Cement Manufacture: Analysis of Fuel Characteristics and Feasibility for Use in the Chinese Cement Sector pdf
... availability of a variety of alternative fuels is assessed in China along with the opportunities and technical challenges associated with using alternative fuels in China’s cement manufacturing ... steel and ash are incorporated into the clinker Tires can be substituted at a rate of 20% or less; higher rates can cause instability and overheating in the kilns, and can also lead to a reduced atmosphere ... preliminary feasibility assessment of using alternative fuels in China This report provides an overview of the technical and qualitative characteristics of a wide range of alternative fuels including...
- 63
- 750
- 0
The Art of Grief The Use of Expressive Arts in a Grief Support Group pptx
... creative spirit: Deborah Koff-Chapin, Carol McIntyre, Judith Koeleman, Sara Baker, Sara Spaulding-Phillips, Debra Mier, Laura Thomae, Carol McNamee, Sandra Baughman, Laura Kiser, Janet Feldman, ... logical relationship, and the feelings may come all at once in an inexplicable ball of raw emotion You may hear complaints of fatigue, exhaustion, lack of energy, pain, or inability to sleep All of ... Alternative Art Forms, Programs, and Stories of Art and Healing Chapter 14 The Painters Deborah Koff-Chapin, Carol McIntyre, and Judith Koeleman 153 Chapter 15 The Writers Sara Baker and Sara...
- 324
- 639
- 0
Báo cáo hóa học: " Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells" doc
... Venezolano de Investigaciones Científicas, Caracas) and a secondary antibody conjugated to alkaline phosphatase Foci were stained using a combination of 5-bromo-4-chloro3'-indolylphosphate p-toluidine ... S, Vaughn DW, Kalayanarooj S, Nisalak A, Norman JE, Ennis FA, Rothman AR: Analysis of plasma viral RNA levels during acute dengue virus infection using quantitative competitor reverse transcription-polymerase ... Chua SK, Hassan Z, Huahab AHA, Chem JK, Mohamad M, Chua KB: Evaluating the sensitivity of a commercial dengue NS1-antigen capture ELISA for early diagnosis for acute dengue virus infection Singapore...
- 8
- 383
- 0
Báo cáo y học: "Duration of bed occupancy as calculated at a random chosen day in an acute care ward. Implications for the use of scarce resources in psychiatric care" pps
... hospital one of four acute wards in the city of Oslo (ca 500.000 inhabitants) The acute wards are often the first step in a chain of facilities that the patient may need in order to regain his ... preceding the chosen day and the number of days of further treatment in the acute ward Twenty-three patients had a total of 776 days, of which 425 (54.8 %) were waiting days as defined above Waiting ... was available at the desired time, the patient had to wait in the acute ward for such a slot The aim of the study was thus to present a novel way of calculating the partial cost efficiency of waiting...
- 6
- 505
- 0
Báo cáo y học: "Clinical use of a modified release methylphenidate in the treatment of childhood attention deficit hyperactivity disorder" pps
... pregnancy and delivery, and had a history of delay in all areas of her development; she walked late, talked late (age 3) and found mainstream schooling very challenging Patient 4’s parents separated ... cousin Patient 2’s clinical examination showed joint laxity but her neurological examination was normal Patient had a diagnostic assessment for ADHD and was found to have very high scores for inattention, ... should also be noted that clinical trial data represent the average values from variable populations Therefore, for each individual, the most rational initial choice (based on clinical trial results)...
- 24
- 597
- 0
Báo cáo y học: "Use of a population-based survey to determine incidence of AIDS-defining opportunistic illnesses among HIV-positive persons receiving medical care in the United States" ppsx
... well as facilitate entry into adequate care Key advantages include the ability to draw inference to the population of patients in care for HIV infection, and beginning in 2008, the availability of ... training in medical records abstraction and HIV including OI definitions and AIDS case definition criteria Quality assurance procedures (e.g., independent re-abstraction of a small sample of ... states had laboratory reporting of at least some CD4 counts and viral loads at the time of the study and the third had an established, clinically-based HIV reporting system that had been in place...
- 7
- 337
- 0
Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx
... significance in the univariate analysis, it failed in the multivariate analysis due to its correlation with clinical Masaoka stage Masaoka stage has a stronger relevance than WHO classification ... http://www.cardiothoracicsurgery.org/content/4/1/33 Table 4: Univariate and multivariate analysis of cancer-related survival in the total populationa Risk factor Multivariate analysisc Univariate analysis ... the log-rank test and in case of significance a univariate analysis and Cox-regression analysis was carried out Results Pathological and Clinical Findings According to the WHO classification 15...
- 10
- 355
- 0
cáo khoa học: " A knowledge translation collaborative to improve the use of therapeutic hypothermia in post-cardiac arrest patients: protocol for a stepped wedge randomized trial" pdf
... than is typically seen in the randomized trials of therapeutic hypothermia All patients greater than 13 years of age, who have suffered a non-traumatic cardiac arrest, have a sustained return of ... on all patients who are transferred to a participating hospital following an OHCA Trained in- hospital data collectors will complete chart abstraction of the variables related to post-arrest care ... information at the point of data entry for each variable to ensure standardization Training prior to data collection will be completed through web-based seminars with ongoing training via email...
- 7
- 435
- 0
Báo cáo y học: "Diagnostic use of infrared thermography in a patient with chronic pain following electrocution: a case report" doc
... general abnormalities in the clinical neurological examination were noted but the patient had evidence of increased tactile cutaneous allodynia in the anterior abdominal wall that was substantially ... is of interest as it documents an abnormality in the cutaneous temperature as determined by infrared digital imaging when all other diagnostic testing did not indicate an abnormality In this patient, ... pain was noted within weeks Although there was a reduction in pain after the administration of pregabalin, there were no differences in pain measurements following the reduction in reported pain...
- 4
- 455
- 0
báo cáo khoa học: " Masculinity as a barrier to men’s use of HIV services in Zimbabwe" potx
... masculinity, it appears that a healthy sexuality is intrinsically linked to a hegemonic masculine sexuality A man who engages in extra-marital sexual relationships and gets an embarrassing disease like ... Zimbabwe Journal of the International AIDS Society 41 Bwambale F, Ssali S, Byaruhanga S, Kalyango J, Karamagi C: Voluntary HIV counselling and testing among men in rural western Uganda: Implications ... that placed key emphasis on previously less important roles, such as being a family man or playing an active role in encouraging other men to make use of available HIV services in a caring and...
- 14
- 603
- 0
Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx
... temporary shunting of peripheral vasculature in order to maintain distal vascular perfusion is rarely employed in civilian surgical practice [2,3], however, it has been gaining popularity in the management ... Tendolkar AG, Magotra RA, Parulkar GB: Temporary intravascular shunts for peripheral vascular trauma J Postgrad Med 1992, 38(2):68-69 Sriussadaporn S, Pak-art R: Temporary intravascular shunt in complex ... Yagubyan M, Panneton JM: Axillary artery injury from humeral neck fracture: A rare but disabling traumatic event Vasc Endovascular Surgery 2004, 38:175-184 Husain AK, Khandeparkar JM, Tendolkar AG,...
- 4
- 342
- 0
Báo cáo y học: " Use of dietary supplements in Olympic athletes is decreasing: a follow-up study between 2002 and 2009" doc
... 25:124-129 19 Alaranta A, Alaranta H, Palmu P, Alha P, Pietila K, Heliovaara M, Helenius I: Asthma Medication in Finnish Olympic Athletes: No Signs of Inhaled beta2-Agonist Overuse Med Sci Sports ... categorized any other way, such as fibres, beastings and conjugated linoleic acid “Vitamin supplements” included multivitamins, vitamins A, B, C, D and E, beta-carotenes and antioxidant agents “Mineral ... supplement use was significantly higher among males than females both in 2002 and 2009 whereas the Canadian study reported all DS use being slightly more common among female athletes both in Atlanta and...
- 8
- 238
- 0
Báo cáo y học: "Use of intravitreal bevacizumab in a patient with a Von Hippel-Lindau-associated retinal haemangioblastoma of the optic nerve head: a case report" docx
... three intravitreal bevacizumab injections in a patient with VHL and a peripapillary retinal haemangioblastoma Treatment with ranibizumab in patients early in the course of their disease, who have ... hypoxia inducible factor degradation, inducing profound intracellular changes that resemble the changes observed after oxidative stress This results in increased levels of several factors including ... Hippel-Lindau (VHL) disease: a review Retina 2007, 27:1-7 Aiello LP, George DJ, Cahill MT, Wong JS, Cavallerano J, Hannah AL, Kaelin WG Jr: Rapid and durable recovery of visual function in a patient...
- 4
- 263
- 0
Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx
... vitro standard external positive sense TCCAGCAAATACACCATCCA In vitro standard external negative sense CTGCTTCACCACCCAATTTT In vitro standard nested positive sense ATAGAATTCGGTATGTTATATGCGATGTCTAGGT1 ... ATAGAATTCGGTATGTTATATGCGATGTCTAGGT1 In vitro standard nested positive sense ATAGGATCCTGCTAAGACTCCCCACCGTAA2 Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT3 Negative sense RNA-specific cDNA ... synthesis CGGTCATGGTGGCGAATAAACTTTATAGATGTTTTTGTTCA3 Positive sense-specific QPCR primer CGGTCATGGTGGCGAATAA Probe TCCTGCAAAAATCCCTTCAACT QPCR tag primer CCCCACTTTATAGATGTTTTTGTTCA Negative sense-specific...
- 11
- 348
- 0
Báo cáo y học: " Exploring the optimum approach to the use of CT densitometry in a randomised placebo-controlled study of augmentation therapy in alpha 1-antitrypsin deficiency" pptx
... and associated supplementary information] The progression of densitometric indices was estimated using an endpoint analysis using the first and last CT scans and incorporating Statistical analysis ... EXACTLE trial was designed to explore the use of CT densitometry as an outcome measure for the assessment of plasma AAT augmentation therapy in individuals with AATD The analytical approach, and ... using the clinical scan protocol Additional quality assurance was achieved using a dedicated Perspex and foam phantom that was scanned prior to site initiation, the first patient scan at each...
- 10
- 439
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25