use a helper to format the price
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc
Ngày tải lên :
11/08/2014, 05:21
... organizations that are able to acquire, assess, adapt, and apply research and those that have fewer supports to so Further, the distinctions that the tool makes in relation to these four areas are ... been available Our observation from the focus groups was that the more useful aspect of the exercise was the discussion that took place as a result of the item on the tool, rather than the actual ... Research was not being adapted, however, on a regular basis In many cases, the roadblock was having a stakeholder partner accept the evidence Participants described how many factors played a role...
- 9
- 506
- 0
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf
Ngày tải lên :
11/08/2014, 16:20
... organizations that are able to acquire, assess, adapt, and apply research and those that have fewer supports to so Further, the distinctions that the tool makes in relation to these four areas are ... been available Our observation from the focus groups was that the more useful aspect of the exercise was the discussion that took place as a result of the item on the tool, rather than the actual ... Research was not being adapted, however, on a regular basis In many cases, the roadblock was having a stakeholder partner accept the evidence Participants described how many factors played a role...
- 9
- 412
- 0
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
Ngày tải lên :
24/09/2012, 17:19
... can be generalize to all customer of McDonald and Max hamburger because the sample is small to represent all the actual customer of both restaurant and also the fact that the students lived together ... enables them to differentiate a brand from another 2.3.4 Brand loyalty According to Aaker (1991, p39), brand loyalty is the attachment that a customer has to a brand” Yoo and Donthun (2001) also ... competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand commonly provide the...
- 88
- 986
- 8
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
Ngày tải lên :
19/02/2014, 17:20
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...
- 12
- 616
- 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
Ngày tải lên :
07/03/2014, 12:20
... such a typical scenario, the activation of growth factor receptors may in turn activate the Ras ⁄ Rac1 pathway, which has been shown to play a critical role in HSF1 activation and HSP up-regulation ... [13] The overexpression of a desaturase gene in Saccharomyces cerevisiae, or the addition of exogenous fatty acids, can change the unsaturated ⁄ saturated fatty acid ratio and exert a significant ... Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a key mediator of both mitogenic and stress signaling pathways,...
- 10
- 452
- 0
Money and happiness a guide to living the good life
Ngày tải lên :
12/03/2014, 14:51
... importantly, understand how to manage it so it maximizes their happiness They have defined the good life” in a way that’s authentic to them, and use money to realize a personal vision Back in the 1990s, ... 2002, meaning they lack the means to ensure themselves of healthy meals and are vulnerable to at least a mild form of chronic malnutrition.3 WEALTH AND VALUES I live in a home that has heat and running ... excited to read the Financial Times,” she says with a laugh When she was 14, her parents started a restaurant, and she began waitressing at night Her father encouraged her to save up for substantial...
- 258
- 358
- 0
A Strategy to Engage the Private Sector in Climate Change Adaptation in Bangladesh docx
Ngày tải lên :
16/03/2014, 14:21
... of the UNFCCC database and the NAPAs Like the latter, most cases are from sub-Saharan Africa, followed by South and Central Asia and Latin America, but in addition it shows that the vast majority ... interface which is a gateway to information on adaptation practices worldwide – the Local Coping Strategies Database It provides a summary of adaptation practices by a large range of organizations, ... Climate Change in Bangladesh The IFC clearly have the potential to play an important catalytic role in the objective of engaging the private sector in Climate Change Adaptation by both managing a...
- 49
- 557
- 0
Greener Events A guide to reducing the environmental impacts of conferences and seminars potx
Ngày tải lên :
16/03/2014, 19:20
... display materials [ ] Seek naturally lighted meeting & exhibition areas [ ] Format any handouts so as to minimise the amount of paper used [ ] Where possible, write material in a re-usable format ... manager by the event manager Venue Choice (and audio visual) Suitability of the venue can mean more than just its layout and facilities Other facilities or amenities in the area and appropriateness ... also It is recommended that this guide is used to help select a suitable venue and to aid planning discussions with management and staff at the venue A copy should be passed to the venue manager...
- 5
- 527
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
Ngày tải lên :
22/03/2014, 12:20
... their living; they need to maintain their families. Also because of the relative large initial investment costs they are in debt and have to repay the banks in short terms. The ... on diseases. Finally, the impact and area of impact are important for the aquaculture, agriculture, industries and other land users. Based on these criteria and the preference ... environment [3]. One of the disadvantages is that the relative importance of evaluation criteria is determined without considering the scales on which the criteria are measured. Another disadvantage is the large amount of ...
- 13
- 487
- 0
hacking vim a cookbook to get the most out of the latest vim editor
Ngày tải lên :
01/06/2014, 10:43
... such a way that the toolbar is just another menu with a special name Hence, adding an icon to the toolbar is just like adding an item to a menu In the case of a 'toolbar menu', you will be able to ... 1991 as a clone of the Unix editor vi for the Amiga platform The first release of Vim for the Unix platform was out a year later and right away, it started to become an alternative to the vi editor ... Development Editor Nanda Nag Indexer Bhushan Pangaonkar Proofreader Chris Smith Nikhil Bangera Layouts and Illustrations Technical Editor Shantanu Zagade Ajay S Cover Designer Editorial Manager Dipali Chittar...
- 224
- 942
- 0
báo cáo hóa học:" A lifeline to treatment: the role of Indian generic manufacturers in supplying antiretroviral medicines to developing countries" pptx
Ngày tải lên :
20/06/2014, 08:20
... Tool, and UNITAID as provided by the Clinton Health Access Initiative [11-14] Antiretroviral transactional data was systematically cleaned and validated using a market intelligence database described ... systematically cleaned and validated all transactional data, we cannot be confident that we have identified all reporting errors in publicly available data Prices are inconsistently reported to the ... Cambridge, MA, USA Page of Authors’ contributions BW designed and coordinated the study, participated in data cleaning and data analysis, and was the lead author on this paper ED performed data...
- 9
- 283
- 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot
Ngày tải lên :
20/06/2014, 15:20
... discriminate amongst those who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also further assess the unidimensionality of the ... equally to the variance of the total score, and can be summed without weighting Item-total scale correlations for all scales were satisfactory implying that the items in each scale contain a similar ... (Table 2), and their transcripts content analysed This generated conceptual ideas about the main areas of relapse management, with around 1000 statements on people’s Riazi et al Health and Quality...
- 8
- 492
- 0
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
Ngày tải lên :
09/08/2014, 01:24
... breast ductal carcinoma: pathologic correlations and prognostic implications Hum Pathol 2001, 32(1):89-94 Sasano H, Frost AR, Saitoh R, Taniyama Y, Nagura H, Matsunaga G, Takehana K, Kimura M, ... expression was significantly associated with grade, lymph node spread, oestrogen receptor status and histological subtype for all invasive carcinomas These are factors that are also easily assessed ... prognostic value as there is a direct statistical association with the development of distant metastases in all invasive carcinomas, the subgroup of invasive ductal carcinomas and in the node negative...
- 9
- 423
- 0
Báo cáo y học: " Mimicking microbial ‘education’ of the immune system: a strategy to revert the epidemic trend of atopy and allergic asthma?" ppt
Ngày tải lên :
12/08/2014, 18:20
... extracts ‘Immunoeducation’: a novel strategy or an utopian goal? Bacteria or bacterial products are already being tested against allergic diseases Encouraging preliminary data are coming from animal ... Authors’ affiliations: DASRS, RMAS, Laboratory of Immunology and Allergy, Pomezia (Rome), Italy (Paolo Maria Matricardi), and Institute of Experimental Medicine, CNR, Rome, Italy (Paolo Maria Matricardi ... ‘unhygienic’ areas inhale and ingest a different kind, variety and amount of bacteria compared with children of farmers and anthroposophic families, who have access to natural soil and eat only biologically...
- 4
- 335
- 0
Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps
Ngày tải lên :
12/08/2014, 18:20
... Several useful SNP databases are available on the World Wide Web (see Table 1); these databases are constantly updated and are growing rapidly However, the data contained in them are far from infallible ... emphasis away from linkage analysis and microsatellite markers towards SNP genotyping and different analytical strategies based on association and haplotype analysis [31–34] Association analyses are ... Sasaki S, Adra CN, Kitaichi M, Inoue H, Yamauchi K, Tomichi N, Kurimoto F, Hamasaki N, Hopkin JM, Izuhara K, Shirakawa T, Deichmann KA: Genetic variants of IL-13 signalling and human asthma and...
- 11
- 491
- 0
Báo cáo khoa học: "Validation of a method to partition the base deficit in meningococcal sepsis: a retrospective study" ppt
Ngày tải lên :
12/08/2014, 22:22
... -7.4) The unmeasured anionrelated base deficit was greater than the total base deficit; this was predominantly due to the alkalinising effect of hypoalbuminaemia (mean albumin effect on base deficit ... two parameters into a single measurement that contains both quantitative and qualitative information This study did not attempt to address the role of lactate, but merely sought to validate a method ... data collection, preliminary data analysis and co-wrote the first draft of the manuscript SMT conceived the study, performed data analysis and co-wrote the first draft of the manuscript AD participated...
- 7
- 325
- 0
Báo cáo y học: " A method to estimate the efficiency of gene expression from an integrated retroviral vector" potx
Ngày tải lên :
13/08/2014, 09:20
... used to detect the ampicillin resistant gene are AmpF (5'-gataacactgcggccaactt-3') and AmpR (5'-ttgccgggaagctagagtaa-3') The reactions were cycled either in a Perkin Elmer thermocycler (DNA Thermal ... (Sigma) was used as an enhancer The reaction was made up to 50 µl with water The primers used to detect HIV-1 LTR are NI2F (5'-cacacacaaggctgacttccct-3') and NI2R (5'gccactccccagtccgccc-3') The ... of the peak count reached by the culture (CT) The data was plotted onto a graph (Figure 4) The data in this table are not directly comparable to that shown in figure because the total numbers...
- 10
- 278
- 0
Báo cáo y học: " Inflammation: a way to understanding the evolution of portal hypertension" ppsx
Ngày tải lên :
13/08/2014, 16:21
... megamitochondria formation because hypoxia and anoxia are known to induce magamitochondria [102] and the mitochondrial function is impaired early by the extrahepatic portal obstruction in the rat [103] Also, ... SWM, Jalan R: Role of ammonia and inflammation in minimal hepatic encephalopathy Metab Brain Dis 2007, 22:125-138 Arias JL, Aller MA, Sanchez-Patan F, Arias J: The inflammatory bases of hepatic ... Therefore, all the mediators that characterize the three proposed phases of the inflammatory response are regulators of the endothelial growth The tight overlapping between the inflammation mediators and...
- 25
- 313
- 0