use a comma before and or or nor preceding the last of a series of three or more words or phrases

Báo cáo khoa hoc:" Combined use of maxillomandibular swing approach and neurosurgical ultrasonic aspirator in the management of extensive clival chordoma: A case report" pptx

Ngày tải lên : 11/08/2014, 10:23

... injury of the structures within the dural space i.e brainstem, basilar Figure Sagittal and axial views of brain MRI scan Sagittal and axial views of brain MRI scan Image shows tumour in the nasopharynx ... were to approach the tumour transcranially Furthermore the proximity of vital structures such as internal carotid arteries and cranial nerves made this surgical approach difficult and very challenging ... the management SJWD: Drafted the clinical presentation and acquired references ZI: Help in drafting the overall manuscript and performed final review All authors have read and approved the final...

4
456
0

Comma before and after conjunctions

Ngày tải lên : 11/07/2015, 09:44

1
212
0

Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

Ngày tải lên : 06/09/2013, 05:48

... populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income populations towards ... behavioral and attitudinal aspects of individuals An in-depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality ... phenomenon formed the basis for the emergence of microfinance in the globalized arena According to the authors, the last four decades have seen serious efforts worldwide to formalize financial service...

23
552
0

Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf

Ngày tải lên : 08/03/2014, 08:20

... statistical analysis was performed using one-way analysis of variance (ANOVA) followed by a Newman–Keuls post-test Data analysis was performed using GRAPHPAD PRISM software and considered statistically ... for lysate preparation and in 6-well plates for glucose uptake assays Differentiated muscle cells or adipocytes were serum starved for h and h, respectively, before addition of appropriate reagents ... media at all stages to select for transformed cells Transfected cells were used for analysis of glucose uptake and GSK3 activity as described earlier Statistical analyses For multiple comparisons...

10
804
0

Improving Maternal, Newborn, Child Health, and Family Planning Programs through the Application of Collaborative Improvement in Developing Countries: A Practical Orientation Guide pptx

Ngày tải lên : 23/03/2014, 06:20

... Afghanistan and Guatemala and the application of active management of third stage of labor (AMTSL) in several countries including Niger, Mali, Afghanistan, and Ecuador increased substantially  Essential ... Newborn Care: In Uganda, the ability of the health facility staff to detect neonatal asphyxia and immediately apply resuscitation increased dramatically  Infant and child care: In Senegal and ... prepare and plan for spread  Selecting and orienting collaborative improvement sites and QI teams  Developing or adapting tools for QI teams and coaches, such as training plans and materials for...

34
542
0

Financial Accounting: A comprehensive and practical online guide for the basics of financial accounting docx

Ngày tải lên : 29/03/2014, 14:20

... information, please visit: www.kesdee.com of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of 28 14 ... 14 Financial Reporting Standards The course discusses the objective of financial reporting and the importance of financial standards in security analysis and valuation The course explores the role ... Calculator Corporate Performance – Dashboard Ratio Calculator Petty Cash Calculator Bank Reconciliation Calculator Further, IFRS is compared with other alternative reporting systems Finally, the...

6
544
1

báo cáo hóa học: " Discrimination and reliability: equal partners? Understanding the role of discriminative instruments in HRQoL research: can Ferguson''''s Delta help? A response" pptx

Ngày tải lên : 18/06/2014, 19:20

... people in a meaningful way This would invalidate any statistical treatment of data that failed to take measurement error into account It does not constitute an argument against the use of Delta It ... 'lose' the quantity of interest, since it appears in both the numerator and denominator A reliability coefficient of 0.8, for example, tells us that 80% of the observed variance is due to true score ... point of my argument Norman correctly states that the reliability coefficient reflects the 'proportion of the variance in the observations that relate to real differences among subjects' Proportions...

3
384
0

báo cáo hóa học: " Tobacco smoke particles and indoor air quality (ToPIQ) - the protocol of a new study" potx

Ngày tải lên : 20/06/2014, 00:20

... Fine particulate air pollution and hospital admission for cardiovascular and respiratory diseases Jama-Journal of the American Medical Association 2006, 295:1127-1134 21 Sunyer J, Basagana X: Particles, ... [4] The wide range of indoor pollutants contains organic or inorganic chemicals, biological aerosols (bioaerosols) and particles A major source of indoor air pollution is the environmental tobacco ... DAG have made substantial contributions to the conception and design of the review, acquisition of the review data and have been involved in drafting and revising the manuscript All authors have...

18
462
0

báo cáo hóa học:" Current status of medication adherence and infant follow up in the prevention of mother to child HIV transmission programme in Addis Ababa: a cohort study" potx

Ngày tải lên : 20/06/2014, 08:20

... the study The median age of the mothers was 25 years and the median schooling completed was Grade The majority of the mothers were pregnant for the second time The median gestational age during ... study was financially supported by the Centre for International Health, University of Bergen, the Meltzer Foundation and Statens Lånekasse, Norway We thank the Addis Ababa City Administration Health ... Sciences, Department of Nursing and Midwifery, Hawassa University, POBox 1560, Awassa, Ethiopia 3School of Public Health, Addis Ababa University, Addis Ababa, Ethiopia 4Faculty of Health and Social Sciences,...

10
712
0

Báo cáo toán học: " Acute myocardial infarction and coronary vasospasm associated with the ingestion of cayenne pepper pills in a 25-year-old male" pot

Ngày tải lên : 20/06/2014, 20:20

... A subsequent coronary angiogram revealed patent coronary arteries, suggesting that the mechanism was vasospasm We postulate that the patient developed acute coronary vasospasm and a myocardial ... with capsaicin Capsaicin, a sympathomimetic agent, may be implicated in the initiation of coronary vasospasm and acute myocardial infarction in the absence of substance abuse, particularly in ... with cardiotoxicity, including coronary vasospasm, supraventricular tachycardia, and acute atrial fibrillation [1,7] Capsaicin also prolongs the cardiac action potential in atrial and ventricular...

14
391
0

Báo cáo hóa học: " Research Article A Simulation Study: The Impact of Random and Realistic Mobility Models on the Performance of Bypass-AODV in Ad Hoc Wireless Networks" pdf

Ngày tải lên : 21/06/2014, 11:20

... Otherwise, the node makes a list of unreachable destinations consisting of the unreachable neighbor and any additional destinations in its local routing table that use the unreachable neighbor as the ... the node randomly and uniformly chooses a direction and moves along that direction until it reaches a boundary After reaching the boundary and stopping for some Tpause , it randomly and uniformly ... discusses the performance of Bypass-AODV and original AODV Finally, Section summarizes the paper and suggests future research directions AODV and Bypass-AODV In this section, we shall summarize the basics...

10
604
0

Báo cáo lâm nghiệp: "Extended length rotation to integrate timber and pine nut production with the conservation of structural diversity in a Pinus pinea (L.) forest" pdf

Ngày tải lên : 07/08/2014, 16:20

... is the number of pairs of samples ua and ua + d which distance from each other is within the distance lag centred at d, and z(ua ) and z(ua +d) are the values that the variable z takes at samplesua ... Table III can be used to calculate the most likely of the four rot risk classes as a function, for each ﬁxed basal area, of the age and the dominant height of the stand, obtaining for each value ... for the estimated age The distribution of the age of the dominant strata and the site index within the forest area can be seen in Figure The classiﬁcation of the forest area in function of the...

9
462
0

Báo cáo khoa học: "Changes in orexin-A and neuropeptide Y expression in the hypothalamus of the fasted and high-fat diet fed rats" doc

Ngày tải lên : 07/08/2014, 18:20

... hypothalamus of the induced SD obese rats as well as the effect of the fasting on normal SD rats Materials and Methods Animals and diets Male Sprague-Dawley rats (260-280 g B.W., Samtako, Korea) ... interpret the facts that the NPY immunoreactivity of the SCN at 84 h of fasting was denser than that of 24 h of fasting, although the SCN has been already known as a site related to the circardian rhythm ... hypothalamus of the fasted and high-fat diet fed rats of the OXA-IR neurons in the LHA of the high-fat (30% fat) diet fed rats increased when compared with that of the normal-fat diet fed rats On the other...

8
385
0

Báo cáo y học: "Collaboration between general hospitals and community health services in the care of suicide attempters in Norway: a longitudinal study" ppt

Ngày tải lên : 08/08/2014, 23:21

... EAF and IR wrote the protocol EM drafted the first manuscript and performed the statistical analysis EM and EAF participated in the acquisition of data All authors participated in the interpretation ... for practice In a national context, clinical standards and practices should be monitored and evaluated against national recommendations at regular intervals Because most of the healthcare system ... in each municipality and the degree of urbanisation of the municipality (rural, rural/urban or urban) were gathered from Statistics Norway Information on the position of the informant in the...

8
502
0

báo cáo khoa học: "Surgical perspectives from a prospective, nonrandomized, multicenter study of breast conserving surgery and adjuvant electronic brachytherapy for the treatment of breast cancer" pps

Ngày tải lên : 09/08/2014, 01:24

... site approach in 27% of cases, a medial approach in 5%, and an inferior approach in 7% A trocar was used during applicator insertion in 27% of cases The procedure lasted a mean of 32 minutes (range ... sedation during balloon applicator insertion, a mean score of 1.8 was tabulated The mean score was 1.5 for the 20 patients who received local anesthesia, for the patient administered sedation, and ... for treatment Factors affecting the success of implanting the balloon applicator and administering the prescribed radiation therapy were analyzed Patients answered a questionnaire after implantation...

10
389
0

Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

Ngày tải lên : 09/08/2014, 07:20

... as the percentage [3H]-7α-OH-DHEA of the total amount of [3H]-label measured Results are expressed as the mean ± standard error of the mean of triplicate samples The data are representative of ... M: Mammalian MAP kinase signalling cascades Nature 2001, 410:37-40 Palanki MS: Inhibitors of AP-1 and NF-kappa B mediated transcriptional activation: therapeutic potential in autoimmune diseases ... manufacturer's protocol using random hexamer primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG)...

10
462
0

báo cáo khoa học: "Feedback GAP: study protocol for a clusterrandomized trial of goal setting and action plans to increase the effectiveness of audit and feedback interventions in primary care" pdf

Ngày tải lên : 10/08/2014, 10:23

... human behavior Edited by: Ramachandran VS Toronto: Academic Press; 1994:71-81 Ajzen I, Manstead ASR: Changing health-related behaviors: An approach based on the theory of planned behavior In The ... explore the barriers and facilitators to Ontario family physicians’ acceptance and utilization of performance feedback, and to examine the perceived actionability of various approaches to the ... investigations, and treatments, data in EMRALD compare well with (and often out-perform) administrative databases [unpublished data] Furthermore, algorithms to identify patients in the EMRALD database...

10
597
0

báo cáo khoa học: " Social networks, work and network-based resources for the management of long-term conditions: a framework and study protocol for developing self-care support" potx

Ngày tải lên : 10/08/2014, 10:23

... health status, use of self-care and self-care support, and a set of validated measures on aspects of social capital and social support A second survey instrument was administered and audio-recorded ... Trusts and the University of Manchester and is part of the National Institute for Health Research The authors are members of the Patient Theme of CLAHRC for Greater Manchester Author details Health ... implementation into practice [5], forms the basis of the Collaboration for Leadership in Applied Health Research and Care for Greater Manchester (CLAHRC) The focus of the research agenda described...

7
331
0