upon acquisition or subscription of the shares the amount pending payment shall be credited to this account with a debit to account 530
Comparing the cultural and linguistic analysis of the English word “meal” and words relating to it in contrast with Vietnamese equivalents.
... according to traditional breakfast as well as conditional breakfast They often have cereal or porridge, egg and bacon followed by toast and marmalade and coffee and tea or they may just have a toast ... or adapt another language as their second language All the language (native and foreign languages), always convey cultural characteristics It is the basic cultural factor that distinguishes this ... eaten between 7and a. m Many English people eat toast with butter or butter and jam (often strawberry, raspberry, apricot or black currant jam), marmalade (a type of jam made from oranges) Others...
- 54
- 1,037
- 1
Tài liệu Báo cáo " STABILITY OF THE ELASTOPLASTIC THIN ROUND CYLINDRICAL SHELLS SUBJECTED TO TORSIONAL MOMENT AT TWO EXTREMITIES " pptx
... Table The calculating results according to the elastic theory Dao Van Dung, Hoang Van Tung 30 Stability of the elastoplastic thin round cylindrical shells subjected to 31 Dao Van Dung, Hoang ... elasto-plastic processes are given in table The calculating results based on the elastic theory are presented in table Figure is graph of the elasto-plastic instability case The comparison between ... according to the theory of elasto-plastic processes when the thickness of cylindrical shell is greater Because these don’t exactly describe mechanical characteristics, investigating must be based on the...
- 9
- 384
- 0
Tài liệu Báo cáo " Study on Monte-Carlo calculation of peak efficiencies of the superpure Hp Ge detector (Gmx) in environmental gamma spectrometry with using MCNP4C2 " pptx
... developed in the Los-Alamos laboratory, USA .The comparision of the obtained calculating results and experimentally measured data has shown out a good agreement between them within the errors ranging ... only to the photon self-absorption in sample itself, but also to the photon absorption in all other materials between the sample and the detector’s active part Monte-Carlo modeling allows to take ... in the box made of PVC having the radius of 5.15 cm and 0.2 cm thick stand It is placed in front of the detector, coaxial with the crystal at the source-detector distance of 0.2 cm The calculated...
- 6
- 463
- 0
Tài liệu Báo cáo khoa học: P25a ⁄ TPPP expression increases plasma membrane presentation of the dopamine transporter and enhances cellular sensitivity to dopamine toxicity pptx
... into the synaptic cleft by fusion of DA storage vesicles with the plasma membrane DA is then transported back into the pre-synaptic neuron via the plasma membrane DA transporter (DAT) The cytosolic ... cDNA coding for human p2 5a and primers 5¢-CACTCTAGACCATGGCTGCATCCCCTGAGCTCAGT-3¢ and 5¢-CACGGATCCCTACTTGCCCCCTTGCAC-3¢ for P25aDN, and 5¢-CACTCTAGACCATGGCTGACAAGG-3¢ and 5¢-CACGGATCCCTACGTCACCCCTGA-3¢ ... transiently transfected with DAT and p2 5a, a- syn or the empty vector as a negative control The x axis shows the total concentration of DA and the y axis shows the DA uptake after 10 The y axis...
- 13
- 596
- 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx
... ACCAGAAGACATTACAGTGAAAATTGA GGGAACCAGCAGTCGTCAAA CGTCCACTGAGAGGATGAGACA AAAGCAGAGCAGAAAAAGTGGAA GGACAATGCCGCGATCAG CAATGAACAAAAAAGTCGCAACA GGGATGGAGGGTAAGACCATACA ACGGAGGTTGACGGGACTT GCTGGCACCACGATTGG ... AATGCTGGCTCTCCCTCGAT GCTTGGCTACTGGACCATCAA GGAAATGGAAATAACAAGACAAATAGC GCGCAACTAATGCTTCCACAA TGACCAAGGCAACAGAACCA AATCAGACGGCCGGTATGTG CGAAAAAGGACAGCAGTTGAAA CTCATCCTCCACCGGATTGT CGTCCGATTTCTTCTCGTGTTT ACCAGAAGACATTACAGTGAAAATTGA ... (5’- to 3’) MTA-1 AATGCTGGCTCTCCCTCGAT GCTTGGCTACTGGACCATCAA GATACAGCAAACGGAAAGTCAACA CAGTTCCTCGGGCCAACA GCCCCCCTCCCACACA CATCTTCGGCCGTCTTTCC GTTCTTGTTCCTGCTCATCAGTATG TGGATCGCCAAAAACTCATG AATGCTGGCTCTCCCTCGAT...
- 11
- 570
- 0
The Conscience of the Game: Baseball''''s Commissioners from Landis to Selig pdf
... today, when such thinking rubs hard against the grain of both labor and management It would be one fan’s plea to major league baseball —owners and players to restore the authority of the of ce ... To amend the antitrust laws applicable to the elimination or relocation of major league baseball franchises.” Commissioner of Baseball Bud Selig is as earnest as a car salesman or a Cubs fan—at ... important to address it and hear out all sides, clearly and calmly, before the corporation that affectionately goes by the name Major League Baseball, Inc., swallows the of ce entirely, along with...
- 243
- 245
- 0
the importance and effective of the ethical principles within an organization (business) to curb fraudulent
... professional accountant important or not? As an accountant of a business, you have to comply with ethical principles of an accountant or not? For example: Transparency in corporate financial reporting, ... sound financial accounting and reporting, effective financial management and competent advice on a variety of business and taxation matters The attitude and behavior of professional accountants in ... financial markets and capital markets, regulatory agencies have raised the issues of particular concern to the quality of information provided to subjects participating in the market Organized...
- 68
- 322
- 0
Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx
... exposures allowed the detection of a protein with a calculated molecular mass of 11.1 kDa migrating between a- and c-3FLAG standard proteins that may correspond to a minor a- secretase cleavage product ... shows that E coli and mammalian cells have different mechanisms to control the aggregation states of these substrates and supports our original hypothesis that mammalian cellular factors enable ... chymotrypsinogen (25 kDa) are indicated by arrows as a high molecular mass peak corresponding to the void volume of this column These data show that zinc can alter the apparent molecular mass of an APPderived...
- 14
- 420
- 0
THE POWER OF THE INTERNET FOR LEARNING: MOVING FROM PROMISE TO PRACTICE pptx
... resources, especially broadband access, that is widely and equitably available and affordable for all learners Continuous, relevant training and support for educators and administrators at all levels ... operational with SIPI downlinks at Laguna Pueblo, Ramah Navajo, Alamo Navajo, and Jemez Pueblo More advanced courses required for national Head Start certification are also being broadcast to sites at the ... in the private sector Imagine what would have happened if the nation's corporate leaders had imposed a similar moratorium in 1990, before they were able to measure objectively any positive impact...
- 185
- 407
- 0
Báo cáo khoa học: N-Glycan structures of squid rhodopsin Existence of the a1–3 and a1–6 difucosylated innermost GlcNAc residue in a molluscan glycoprotein pot
... Kurono, M & Takahashi, N (1991) Calculated two-dimensional sugar map of pyridylaminated oligosaccharides: elucidation of the jack bean a- mannosidase digestion pathway of Man9GlcNAc2 Anal Biochem ... 1) This fraction (tentatively named glycan B) was further chromatographed on the amide-silica column and separated into two fractions, glycan B1 and glycan B2, with a molar ratio of 17 : (data ... referring to their retention time and EI spectra, compared against authentic standards attached to the innermost GlcNAc residue, i.e Galb1– 4Fuca1–6 and /or the Fuca1–3 residues, act as a stopper,...
- 6
- 429
- 0
Báo cáo khoa học: Deviation of the neurosporaxanthin pathway towards b-carotene biosynthesis in Fusarium fujikuroi by a point mutation in the phytoene desaturase gene ppt
... neurosporaxanthin This may actually be the case for torulene, as indicated by the fast decoloration of a torulene-accumulating mutant upon aging (unpublished observation) The decreased accumulation ... primers CarBG-2F (5¢-TGGGCGAGCTCATGAGCGACATTAAGAA ATCTG-3¢) and CarBG-3R (5¢-CGCTCAGAACGACA CCGTTTG-3¢) The presence of the carB36 mutation was checked using a FokI (Takara Shuzo, Kyoto, Japan) restriction ... were isolated after transformation of the SF1 strain with a plasmid carrying carB36 In five of them, Southern blot analyses showed the incorporation of a single copy of the plasmid at the carB locus...
- 16
- 440
- 0
Báo cáo khoa học: Constitutive expression of the human peroxiredoxin V gene contributes to protection of the genome from oxidative DNA lesions and to suppression of transcription of noncoding DNA pdf
... CTCCTTAATGTCACGCACGAT ASAT-D 22 TCTTTGTGATGTGTGCATTCAA ASAT-R 20 TATTCCCGTTTCCAACGAAG ALU-D 20 ACGAGGTCAGGAGATCGAGA ALU-R 19 GATCTCGGCTCACTGCAAG S3T-D 19 AATCAACCCGAGTGCAATC S3T-R 22 TCCATTCCATTCCTGTACTCGG ... underlined) gene: TTTGAAGAAGTCGTGCTGCTTCATGGA AGCAGCACGACTTCTTCTTTTT (top strand) and CTA GAAAAAGAAGAAGTCGTGCTGCTTCCATAAGCAG CACGACTTCTT (bottom strand) Bacterial clones with insertions in these oligonucleotides ... complementary hairpin oligonucleotides targeting PRDX5 cDNA (exons and underlined) were: TTTGAGA ACCTCTTGAGACGTCGATGACGTCTCAAGAGGTTC TCTTTTT (top strand) and CTAGAAAAAGAGAA CCTCTTGAGACGTCATCGACGTCTCAAGAGGTTCT...
- 11
- 463
- 0
assessment of the stress and strain levels at geometrical discontinuities under elastoplastic conditions a case study
... factor Kt as well as the pattern of the stress distribution The photoelastic model of the plate with a central hole was made of a polymer plate with thickness of 6.35 mm To avoid effects due to ... magnitude of the theoretical stress concentration factor Kt and compare it with the values determined experimentally and also values presented in the literature For the elastoplastic analysis, a constitutive ... distribution at the root of different kinds of geometrical discontinuities are similar one to another and could be satisfactorily characterized by two parameters: the notch root and the theoretical stress...
- 9
- 410
- 0
báo cáo hóa học: " Psychometric properties of the Child Health Assessment Questionnaire (CHAQ) applied to children and adolescents with cerebral palsy" ppt
... measures the functional capacity and independence in ADL and has already been applied to patients with other disabling conditions It was translated, culturally adapted and validated for the Portuguese ... http://www.hqlo.com/content/6/1/109 that corresponds to the scale of overall evaluation, the word "arthritis" was replaced with "cerebral palsy" This was the only adaptation made in order to apply the instrument to this study ... evaluate and to discriminate patients with smaller motor incapacity The floor effect was greater for the arising, walking and gripping domains only for the patients with the hemiparetic form of...
- 10
- 502
- 0
Báo cáo hóa học: " Development and preliminary evaluation of the participation in life activities scale for children and adolescents with asthma: an instrument development study" pptx
... participation was possible * I want to have a pet to care for, but can't because of my asthma * Living on a farm, I have to take my medication everyday so I can care for my horse and play with the dogs and ... computing the mean scores for each of the three indicators Scoring Scoring of the Participation in Life Activities Scale is completed by computing the mean scores for each of the three indicators before ... wide range of factors and vary across individuals This perspective highlights the importance of having participants with asthma select their activities and allowing the activities to change as children...
- 11
- 628
- 0
Báo cáo hóa học: " Reliability and construct validity of the Participation in Life Activities Scale for children and adolescents with asthma: an instrument evaluation study" docx
... indicators) and a path from SIRS to PLA was carried out using weighted least squares method appropriate for ordinal categorical indicators [24] Root Mean Square Error of Approximation (RMSEA) and ... Reliability Item to Total Scale Alpha & if Item Correlation Deleted Factor Analysis Principal Components KMO Sampling Rescaled Factor Rescaled Amount of Adequacy Loading (PC) Variance Explained Ages ... computing the mean scores for each of the three indicators Scoring Scoring of the Participation in Life Activities Scale is completed by computing the mean scores for each of the three indicators before...
- 10
- 908
- 0
báo cáo hóa học:" Japanese version of the Dermatology Life Quality Index: validity and reliability in patients with acne" potx
... patients with acne was also lower than that of all the other patients except those with coronary heart disease These findings show that the impact of acne on QOL can be as great as that of severe and ... translation based on the two translations, and a single Japanese version was created A translator whose native language was English then translated the Japanese version back into English Based on the ... disease The questionnaire together with the changes described above was then submitted to the authors of the original questionnaire, and they approved the Japanese version The expression "because...
- 7
- 394
- 0
Báo cáo hóa học: " Dynamic tuning of the IEEE 802.11 distributed coordination function to derive a theoretical throughput limit" pot
... when a node completes its data transmission, it obtains another Backoff value via the Backoff procedure before it starts another round of data transmission If the Backoff value obtained from the ... state can be calculated as follows The probability of an idle time slot is calculated as (5) and referred to as Pi: By dividing the numerator and denominator, respectively, by the total number of ... average that participate in a collision must be used for the analysis Thus, we set the value of M in (9) to be a value that approaches infinity, and then check whether k approaches a constant value...
- 12
- 358
- 0
báo cáo hóa học:" Research Article Pitch- and Formant-Based Order Adaptation of the Fractional Fourier Transform and Its Application to Speech Recognition" pptx
... chirped autocorrelations and the fractional Fourier transform are used to estimate the features which can characterize a measured marine-mammal vocalization In [21], sinewave analysis and synthesis ... Consequently, there are relatively fast changes of pitch which are usual and informative In Mandarin, there are four basic lexical tones and a neutral tone The number of tonal syllables is about 1,300, and ... the pitch rate will be smeared This also holds true for the formants, because the frequency variations of the formants are generally smaller than those of the harmonics; that is, the chirp rates...
- 14
- 384
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008