0

undersaturated oil reservoir active aquifer status at time t

Percolation theory in research of oil-reservoir rocks ppt

Percolation theory in research of oil-reservoir rocks ppt

Tự động hóa

... simplest result Q = 1, P = 0, which means that at that time the system is under the percolation threshold Furthermore, this equation also has two different results, but these result mentioned ... not always bad because density P that is gradually constant to L and p is larger than pc, at that time there is a correlated length ξ(p), a limitation so that: M(L) L1.9 to L < ξ and M(L) L2 to ... model; thus, when mentioning to the percolation of the Bethe net, one very important thing is to imagine that it only occurs inside the net but not effect the outerest surface The evaluations...
  • 86
  • 725
  • 0
Báo cáo y học:

Báo cáo y học: " Relationship of compartment-specific structural knee status at baseline with change in cartilage morphology: a prospective observational study using data from the osteoarthritis initiative" pps

Báo cáo khoa học

... features of OA, did not predict cartilage loss in the current study, but knees with medial JSN tended to exhibit greater cartilage loss in the MFTC than those without JSN, although the relation ... Pharmaceuticals Corporation, GlaxoSmithKline; and Pfizer, Inc Private sector funding for the OA Initiative is managed by the Foundation for the National Institutes of Health The quantitative MR image ... isolation, in that most of the features found to be associated with higher rates of cartilage loss and greater SRMs were features of advanced structural disease The current results should nevertheless...
  • 10
  • 483
  • 0
Báo cáo y học:

Báo cáo y học: "Immune restoration disease and changes in CD4+ T-cell count in HIV- infected patients during highly active antiretroviral therapy at Zewditu" ppsx

Báo cáo khoa học

... 7:46 http://www.aidsrestherapy.com/content/7/1/46 Page of Table Pattern of past opportunistic infections and opportunistic infections at time of HAART initiation in HIV- infected patients, at Zewditu ... IRD patients (P
  • 7
  • 332
  • 0
How to maximize part-time students ’ involvement in English speaking lessons at Hai Phong Foreign Languages Centre

How to maximize part-time students ’ involvement in English speaking lessons at Hai Phong Foreign Languages Centre

Thạc sĩ - Cao học

... positive contribution to learners motivation to learn Garder and Lambert (1985) introduces two major types of motivation: Instrumental motivation and Integrative motivation, Resultative motivation and ... participants say that their teachers give them good comment after their presentation although their performance is not really good Only 9% of them state that their teachers criticize their mistakes after ... work Teacher gives students the four following situations and let them choose the situation they like best (see the situations in Appendix 4) Task: Imagine that you want to start a conversation...
  • 40
  • 1,604
  • 10
RELATIONSHIP BETWEEN ALLOCHTHONOUS DOC CONCENTRATION AND A SPECIFIC UV254 ABSORBANCE (SUVA) AT A MESO-STRATIFIED RESERVOIR

RELATIONSHIP BETWEEN ALLOCHTHONOUS DOC CONCENTRATION AND A SPECIFIC UV254 ABSORBANCE (SUVA) AT A MESO-STRATIFIED RESERVOIR

Môi trường

... be suspected of that organic matter in water attributed mainly to autochthonous organic matter by algae at the temporally intermediate period Statistics between DOC and UVA254 supported this suspicion ... Soyang reservoir (Kim et al 2000) Consequently, it was quite hard to estimate exactly the extent of autochthonous organic matter within total organic matter existed in reservoir water So that it was ... both DOC and UVA254 at middle and bottom layer was almost homogenous and the extent of NOM in wet season was about times greater than that in dry season It meant that allochthonous DOC in either...
  • 7
  • 428
  • 0
Finite time exergoeconomic performance optimization for an irreversible universal steady flow variable-temperature heat reservoir heat pump cycle model

Finite time exergoeconomic performance optimization for an irreversible universal steady flow variable-temperature heat reservoir heat pump cycle model

Vật lý

... THout and TLout are calculated by equations (26) and (27) Assuming that the environmental temperature is T0 , the exergy output rate of the cycle is: A=∫ THout THin CH (1 − T0 T )dT − ∫ TLout ... [ (T4 − THout ) − (T5 − THout1 )] / ln[ (T4 − THout ) / (T5 − THout1 )] = C H (THout − THout1 ) = Cwf (T4 − T5 ) = C H EH (T4 − THout1 ) QL1 = U L1[(TLout1 − T2 ) − (TLout − T1 )] / ln[(TLout1 ... to the properties of heat transfer, heat reservoir, working fluid, and the theory of heat exchangers, the heat transfer rates ( QH and QH ) released to the heat sink and the heat transfer rates...
  • 18
  • 609
  • 0
Tài liệu The Right Stock At The Right Time - Prospering In The Coming Good Years (Wiley - 2003) (pdf) ppt

Tài liệu The Right Stock At The Right Time - Prospering In The Coming Good Years (Wiley - 2003) (pdf) ppt

Đầu tư Chứng khoán

... from the low of 1962 to 1966 to 1970 That got me to wondering whether there was some repetitive pattern at work here that no one had told me about My father always advised me that what little ... all that, are at best difficult to trade or use to invest Yet there are several very dominant cycles that seem to hold water, and more importantly, hold up in the future That’s what much of this ... idea that things might get better, that perhaps the future of America was bright, not dim In retrospect this was one of the all -time market calls Wherever I went throughout the United States,...
  • 239
  • 425
  • 0
Tài liệu ADX Active Digital Cross-Connect A Space in Time pptx

Tài liệu ADX Active Digital Cross-Connect A Space in Time pptx

Phần cứng

... A Space in Time Early GSM operators chose TDM because of its many advantages The technology is time- tested and relatively simple, enabling operators at any given time to know what traffic is ... It complies with SDH standards and supports operation and administration features required for successful integration into an existing transport network The ADX, which resides at the edge of the ... Size does matter The size of the ADX itself is ideal for remote sites with tight space restrictions The system fits into the slot typically used for the copper distribution frame block The ADX is...
  • 4
  • 296
  • 0
Tài liệu How to cheat at installing, configuring and troubleshooting active directory and DNS doc

Tài liệu How to cheat at installing, configuring and troubleshooting active directory and DNS doc

An ninh - Bảo mật

... responsibility can be applied at the OU level The Administrator can assign administrative rights for each object’s attributes and whether that control can be inherited The result is that the appropriate ... Removes the metadata associated with the domain selected in the Select operation target submenu Removes the metadata associated with the domain controller selected in the Select operation target submenu ... of them Automated installation is a function that Windows 2000 inherited from Windows NT An automated installation will reduce the deployment time for multiple machines, but it buys little time...
  • 75
  • 617
  • 0
Tài liệu Wiley The Right Stock At The Right Time Prospering in the Coming Good Years pptx

Tài liệu Wiley The Right Stock At The Right Time Prospering in the Coming Good Years pptx

Đầu tư Chứng khoán

... from the low of 1962 to 1966 to 1970 That got me to wondering whether there was some repetitive pattern at work here that no one had told me about My father always advised me that what little ... all that, are at best difficult to trade or use to invest Yet there are several very dominant cycles that seem to hold water, and more importantly, hold up in the future That’s what much of this ... idea that things might get better, that perhaps the future of America was bright, not dim In retrospect this was one of the all -time market calls Wherever I went throughout the United States,...
  • 238
  • 453
  • 3
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx

Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx

Báo cáo khoa học

... exactly 10 at the relevant temperature and the catalytic activity at that temperature was then determined The inactivation temperatures for all the E1 mutants were found to be 5–10 °C below that of ... wild-type E1; mutants with a replacement of E1aY281 tended to lose catalytic activity at a slightly lower temperature than mutants retaining that residue The E1aR267A mutant displayed a distinctly ... activity at higher temperatures than the other E1a mutants or than wild-type E1 The specific activity of the E1aD276A mutant increased steadily to reach twice that of wild-type E1 at 65 °C, after...
  • 10
  • 459
  • 0
Báo cáo khoa học: Binding of ATP at the active site of human pancreatic glucokinase – nucleotide-induced conformational changes with possible implications for its kinetic cooperativity doc

Báo cáo khoa học: Binding of ATP at the active site of human pancreatic glucokinase – nucleotide-induced conformational changes with possible implications for its kinetic cooperativity doc

Báo cáo khoa học

... simulations Steady-state kinetics The steady-state kinetic properties of WT GST-hGK were determined with Glc as the variable substrate at high or low concentrations of MgATP (Table 3) Positive ... increased to 14.3 ± 1.7 mm The fact that the kinetic cooperativity is dependent on the MgATP concentration is consistent with previous data reported for the rat liver isoform [33,34] With MgATP as the ... compilation ª 2011 FEBS J Molnes et al ATP binding at active site of human glucokinase Table The kinetic constants for WT GST–hGK at high and low concentrations of the fixed substrate The catalytic...
  • 15
  • 374
  • 0
Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot

Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot

Báo cáo khoa học

... H546R GGTCGGTCAATTGCGGCTCCTCGCGGCCGTATG GGTCTAGCTCTGTTCACGCCATGGTCATGATGCG GGTCTAGCTCTGTTCACTTCATGGTCATGATGCG CCGACCATTTGGCCCTTCCTGCTGCC CGCCAACACGATTGCCCACCCAGTTGGAACGG GCCAACACGATTTTACGACCAGTTGGAACGGC ... GCCAACACGATTTTACGACCAGTTGGAACGGC GCCAACACGATTTTCCTCCCAGTTGGAACGGCC GCCAACACGATTTTCAGCCCAGTTGGAACGGCC GCCAACACGATTTTCCGCCCAGTTGGAACGGCCv CCCTTCGCGCCCAACGCACTTACCCAAGGACCG CCCTTCGCGCCCAACGCAAGTACCCAAGGACCG CCCTTCGCGCCCAACGCACGCACCCAAGGACCG ... sodium phosphate, pH 6.0, at 24°C) Benzyl alcohol Wild-type Km kcat kcat ⁄ Km Y78A Km kcat kcat ⁄ Km Y92F Km kcat kcat ⁄ Km L315A Km kcat kcat ⁄ Km F501A Km kcat kcat ⁄ Km F501Y Km kcat kcat ⁄ Km m-Anisyl...
  • 11
  • 471
  • 0
Báo cáo khoa học: Auto-methylation of the mouse DNA-(cytosine C5)-methyltransferase Dnmt3a at its active site cysteine residue pot

Báo cáo khoa học: Auto-methylation of the mouse DNA-(cytosine C5)-methyltransferase Dnmt3a at its active site cysteine residue pot

Báo cáo khoa học

... double-stranded DNA substrate abolished the tritium incorporation into the MTase but at the same time the DNA got efficiently methylated This result illustrates that after binding both substrates ... auto-methylation, thereby protecting the genome against aberrant methylation In this respect it is important to note that we observed much higher levels of auto-methylation after incubation of the Dnmt3a-C ... because it lies in close proximity to the methyl group of AdoMet and is the most reactive residue in the catalytic center of the enzyme To test whether the catalytic cysteine is the target for auto-methylation,...
  • 9
  • 437
  • 0
SOUTH AFRICAN MEMORIES SOCIAL, WARLIKE & SPORTING FROM DIARIES WRITTEN AT THE TIME docx

SOUTH AFRICAN MEMORIES SOCIAL, WARLIKE & SPORTING FROM DIARIES WRITTEN AT THE TIME docx

Du lịch

... settled It was even rumoured that there was a serious hitch in the negotiations, and that Lord Salisbury had presented an ultimatum to the effect that, unless the President ratified the Convention ... residence stood in the centre of the little town, adjacent to the railway-station At that time bomb-proof underground shelters, with which Mafeking afterwards abounded, had not been thought of, or time ... carriage at ten o'clock at night, and told that, since he had no passport, he was to be arrested on the charge of being a spy In vain did he tell them that only at the last station his passport had...
  • 212
  • 315
  • 0
Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt

Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt

Báo cáo khoa học

... F258I: 5¢-TAC CAA GTG ATT TCC GGT GGT-3¢; F258Y: 5¢-TAC CAA GTG TAT TCC GGT GGT-3¢; F258W: 5¢-TAC CAA GTG TGG TCC GGT GGT-3¢; E292S: 5¢-GG AAC GTC GCT GGT TCA TGG TCT GCT GCT TTG-3¢ Outside primers ... network of interactions that hold the terminal glucose of the bglucan substrate in the )1 subsite at the bottom of the active site pocket [20] The entrance to the active site pocket of Exg is flanked ... sensitive to mutation than the hydrolysis assay is interesting This could suggest that, for the mutant enzymes, there is different partitioning of the covalent glucosyl intermediate between the...
  • 13
  • 498
  • 0
Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx

Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx

Báo cáo khoa học

... energy of the reactive tetrahedral intermediate (TI) In addition, it contributes to correct positioning of the substrate against the catalytic SerB1 GlnB23 was also shown to interact with the nucleophile ... acylation, proceeds via two steps separated by a relatively stable intermediate, the TI The structures of the enzyme–substrate (ES) complex, AE with free aniline, the TI, and two transition states ... phenylmethanesulfonyl-SerB1 derivative These structures are mimics of the stationary points along the reaction pathway; they depict the changes in the spatial structure of the active site during catalysis...
  • 10
  • 425
  • 0
Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx

Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx

Báo cáo khoa học

... L-Phe to a second putative site in the regulatory domain was suggested to induce a conformational transition that modies the intra-subunit interaction between the regulatory and the catalytic domains ... biopterin cofactor on the rate of phosphorylation of Ser16, the limited proteolysis by trypsin and the substrate induced conformational transition (hysteresis) related to catalytic activation The ... conformational states include a ground state for the ligand-free enzyme, an activated state with bound substrate (L-Phe), an inhibited state with bound H4biopterin and nally the state of catalytic turnover,...
  • 10
  • 470
  • 0

Xem thêm

Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25