ua is a software package that composes reads replies to and forwards messages
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
Ngày tải lên :
15/02/2014, 01:20
... but accessing these putative substrates is not trivial An alternative approach would be to seek accumulation of the substrate of NirF in a mutant that lacks NirF; this too is not trivial as the ... SB123 and SB124 The mutants generated in this study are detailed in Table Bacterial strains, plasmids and growth conditions The bacterial strains and plasmids used in this study are detailed in Table ... suggests that the activity of NirF cannot be similar to that of Met8P activity where a comparable mutation is inhibitory A puzzle is that some NirF sequences, notably for two strains of Ps aeruginosa,...
- 12
- 613
- 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf
Ngày tải lên :
14/03/2014, 13:20
... meshes are also usually distorted at the areas close to the boundaries of the computational domain (low orthogonality at the boundaries) Moreover this distortion property propagates far into the ... one to one inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6] For short, the formulae for Y and Z coordinates are the same and ... this practical case, it should be noted that it is usually desirable that the mesh in the area where the contour lines are close to each other, i.e big slope, is finer than the mesh in the area...
- 14
- 402
- 0
The RAND Corporation is a nonprofit research organization providing objective analysis and effective solutions that address the challenges facing the public and private sectors around the world. potx
Ngày tải lên :
22/03/2014, 09:20
... resources to reduce disparities in access and quality of care; and public education and engagement campaigns that attempt to change public attitudes and standards, educate community residents, and ... their areas of expertise Integrated Information Resources A few programs have integrated data systems that enable case managers or care coordinators to track individual families and share data across ... maternal and child health care services across physical and behavioral health care systems and between physical and behavioral health MCOs • Building mechanisms for collaboration among state and...
- 79
- 343
- 0
Báo cáo khoa học: Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinase-associated protein) gene expression pdf
Ngày tải lên :
30/03/2014, 08:20
... CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG S: GTGCTGTTAGCCCTTATTTCCTACTATTAAAGAGGCTTCCATGCCAAACATAGCC F: GGCTATGTTTGGCATGGAAGCCTCTTTAAATAGTAGGAAATAAGGGCTAACAGCAC S: CTAGTGTCTGATGCTGCAACCACCGCCAC F: GTGGCGGTGGTTGCAGCATCAGACACTAG ... GTGTGGCAGGACGCTGCGCCTTTCACAG F: CTGTGAAAGGCGCAGCGTCCTGCCACAC S: TCCCAGAGGCACTGTACATCTCTG F: CAGAGATGTACAGTGCCTCTGGGA S: GCCTCTTTAGAAGTCAATAGTAGG F: CCTACTATTGACTTCTAAAGAGGC S: GCCTCTTTAGAAGATCAAAAGTAGG ... External S: GAGACTGGATAGGCTTGTAG External F: GCGCCGAGGACCCCG Internal S: ACAAAGACCTGGTAACTCA Internal F: GAACCTTACTCCACAATTAG S: CCCTGAAGAAACCAGAGATGGCCTCTGGGATGGGACTGGG F: CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG...
- 16
- 363
- 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
Ngày tải lên :
25/10/2012, 10:35
... 36 and health-related quality of life after intensive care in Morocco Acta Anaesthesiol Scand 2007, 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral ... presented as the mean ± standard deviation for variables with a normal distribution, and as the median and interquartile range for variables with skewed distributions Parametric or nonparametric ... drafted the manuscript and participated in the acquisition of data and the study design JB participated in the acquisition of data NM helped to draft the manuscript, and participated in the acquisi-...
- 10
- 597
- 0
FOREST AND PAPER INDUSTRY - A mature industry that has done much to clean up its act. pptx
Ngày tải lên :
09/03/2014, 00:20
... recycled, such as archives and libraries, and papers used in construction materials (eubusiness.com) Same data displayed graphically 20 Corrugated cardboard boxes: Generated waste: 29.7 million tons or ... requirement: Paper must be made from a fibrous material Fibers can be found in biomass other than wood For example: KENAF - Kenaf is a plant originating from Africa and is a member of the hibiscus family, ... Substitution as avoidance: The issue of “paper vs plastic” Paper bag vs plastic bag at grocery store Paper cup vs polystyrene cup In each case, the life-cycle analysis shows that the non-paper choice is...
- 25
- 222
- 0
Báo cáo khoa học: Hepatocyte growth factor activator (HGFA): a serine protease that links tissue injury to activation of hepatocyte growth factor pdf
Ngày tải lên :
15/03/2014, 11:20
... Miyazawa K, Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiyama O, Takahashi K et al (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte ... growth factor activator K Miyazawa agonist ⁄ antagonist activity J Biol Chem 271, 13110– 13115 31 Kaibori M, Inoue T, Sakakura Y, Oda M, Nagahama T, Kwon AH, Kamiyama Y, Miyazawa K & Okumura T (2002) ... Sakiyama O, Takahashi K, Miyazaki H, Hashimoto S & Daikuhara Y (1988) Purification and partial characterization of hepatocyte growth factor from plasma of a patient with fulminant hepatic failure J...
- 7
- 502
- 0
Panorama: A Database System that Annotates Its Answers to Queries with their Properties potx
Ngày tải lên :
16/03/2014, 16:20
... and a language and a system that have been implemented to realize this general goal This paper is organized as follows Section establishes a general and formal framework for asserting and manipulating ... real world value Thus, a null value is practically a declaration of the unsoundness of a particular data value The Closed World Assumption states that a database contains all the data that it attempts ... SYSTEM THAT ANNOTATES ITS ANSWERS 63 In addition, Panorama extends the query language with three statements to manipulate and query the meta-database To add a new property view to the meta-database,...
- 23
- 332
- 0
Báo cáo khoa học: Glycolipids with nonreducing end a-mannosyl residues that have the potential to activate invariant Va19 NKT cells pptx
Ngày tải lên :
30/03/2014, 08:20
... such as a- galactosyl ceramide (a- GalCer) [4] isolated from marine sponge [5], a- glucuronosyl ceramide and a- galacturonosyl ceramide from a- proteobacteria [6,7], and intracellular lysosomal isoglobotriaosyl ... here As well as a- ManCer [14] and its derivatives [18], 2,6-di -a- mannosyl phosphatidylinositol (a- Man)2-PtdIns, a partial structure of bacterial lipoarabinomannan (LAM) [21]) and a- mannosyl 1– 4a- glucosamine-1–6-phosphatidylinositol ... glycosphingolipid synthesis Proc Natl Acad Sci USA 93, 4638–4643 20 Watanabe R, Ohishi K, Maeda K, Nakamura N & Kinoshita T (1999) Mammalian PIG-L and its yeast a- Mannosyl glycolipids that activate NKT cells...
- 12
- 370
- 0
Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc
Ngày tải lên :
18/06/2014, 16:20
... Barrett metaplasia; GERD, Gastro-Esophageal Reflux Disease; EAC, esophageal adenocarcinomas; ESCC, esophageal squamous-cell carcinomas; †significance is related to GERD; ††significance is related ... binds, and all contaminants were washed away efficiently Pure, concentrated RNA was eluted in water and stored at -70°C until further analysis The amount of total RNA was determined by measuring absorbance ... expressed as 2-ΔΔCt Statistical analysis Statistical analysis was performed with MedCalc Software, Version 11.3.2 (Mariakerke, Belgium) All values were expressed as Median ± Interquartile Range (IQR)...
- 11
- 647
- 0
Báo cáo y học: "Chromothripsis is a common mechanism driving genomic rearrangements in primary and metastatic colorectal cancer" pdf
Ngày tải lên :
09/08/2014, 23:20
... 470:214220 Totoki Y, Tatsuno K, Yamamoto S, Arai Y, Hosoda F, Ishikawa S, Tsutsumi S, Sonoda K, Totsuka H, Shirakihara T, Sakamoto H, Wang L, Ojima H, Shimada K, Kosuge T, Okusaka T, Kato K, Kusuda J, ... Rearrangement fusion points were visualized by Circos software [38] SNP-array analysis DNA from all 16 tumor and control samples was analyzed by Illumina Cyto12 SNP arrays according to standard ... and matching healthy samples SNP-array data were submitted to the NCBI GEO archive and are available under accession number GSE32711 Mutational profiling Mutational analysis of 1296 kinases and...
- 29
- 405
- 0
Báo cáo y học: "Timing of adequate antibiotic therapy is a greater determinant of outcome than are TNF and IL-10 polymorphisms in patients with sepsis." potx
Ngày tải lên :
13/08/2014, 01:20
... hospital, and the dose and pattern of administration were in accordance with current standards Failure of organs was evaluated using the Sequential Organ Failure Assessment (SOFA) scale on admission ... order to evaluate the presence of interactions and confounding factors among variables A multivariate analysis using logistic regression analysis was used to determine variables independently associated ... factors such as organ failure [2] Valles and coworkers [4] found that inadequate antibiotic therapy was the most important determinant of survival in bacteraemic patients, and this finding was...
- 12
- 293
- 0
Words that take the prepositions to and for
Ngày tải lên :
17/07/2015, 20:11
... him astray Prepared for We are prepared for everything Qualified for He is qualified for the job Respect for I have great respect for him Be first to know when grammar rules change! Sign up to ... She has no desire for fame Except for Except for John, everyone else attended the function Fondness for She has great fondness for children Infatuation for His infatuation for his master’s daughter ... respect for him Be first to know when grammar rules change! Sign up to our newsletter here: englishgrammar.org (It's free) Powered by TCPDF (www.tcpdf.org) ...
- 2
- 215
- 0
Words that take the prepositions to and for
Ngày tải lên :
29/08/2016, 17:57
... led him astray Prepared for We are prepared for everything Qualified for He is qualified for the job Respect for I have great respect for him Stay on top of your writing! Download our grammar guide ... She has no desire for fame Except for Except for John, everyone else attended the function Fondness for She has great fondness for children Infatuation for His infatuation for his master’s daughter ... respect for him Stay on top of your writing! Download our grammar guide from www.englishgrammar.org to stay up -to- date Powered by TCPDF (www.tcpdf.org) ...
- 2
- 144
- 0
How to setup a Linux system that can boot directly from a software RAID
Ngày tải lên :
18/09/2012, 10:11
... the partitioning utility to create the software RAID partitions In the example both disks are split into a 3498Mb and a 596Mb software RAID partitions: Device Type Size Mbytes /dev/hda1 software ... disks already contains data, make a backup if needed (all existing data of partitions involved in the process will be lost), and delete or resize existing partitions to create space for the software ... replace the failed one is available it can be installed into the system, partitioned to have the two software RAID partitions to replace the ones of the failed drive The new partitions can be added...
- 14
- 567
- 1
Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx
Ngày tải lên :
05/03/2014, 17:20
... (SignalP V2.0 and TargetP V1.0) [35-37] were used to determine that a putative signal peptide and a cleavage site exist in ePAD and AAH53724 (an egg and embryo abundant peptidylarginine deiminase), ... with anti-PAD V (N) and LCA, and (I – L) double labeled with ABL2 and LCA All anti-PAD V labeling is shown in green, except in A where it is red DNA stain in A is green ABL2 labeling is green and ... the ABL2 antibody and that PAD (ABL2 antigen, p75) is present in the cortical granules of mouse oocytes Localization of PAD (p75) after artificial activation and fertilization To demonstrate that...
- 22
- 519
- 0
Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx
Ngày tải lên :
14/03/2014, 23:20
... AGCTTTTGGTGAATCTT-3¢; C126V, 5¢-TAATTTAAAA GCCGTTGTAGTTTTTGGTGAATCTT-3¢; C126M, 5¢-T AATTTAAAAGCCGTTGTAATGTTTGGTGAATCTT-5¢; and C126T, 5¢-TAATTTAAAAGCCGTTGTAACTTTT GG TGAATCTT-3¢ Experimental procedures ... site, was 5¢-TAAT TTAAAAGCCGTGATATCTTTTGGTGAATCTT-3¢, and the primers used for generating the five mutants were: C126S, 5¢-TAATTTAAAAGCCGTTGTATCCTTTGGT GAATCTT-3¢; C12 6A, 5¢-TAATTTAAAAGCCGTTGT AGCTTTTGGTGAATCTT-3¢; ... located automatically by coot, and validated if a peak was observed above 3r on a difference map and above 1.5r on a double difference map The B-factors of all atoms were also refined, and alternative...
- 12
- 393
- 0
Báo cáo khoa học: Mouse RS21-C6 is a mammalian 2¢-deoxycytidine 5¢-triphosphate pyrophosphohydrolase that prefers 5-iodocytosine pdf
Ngày tải lên :
23/03/2014, 06:20
... also bound to both ITP- and ATP-agarose (Fig 2C) D Agarose ATP-agarose (kDa) 25 (kDa) ITP-agarose B ITP-agaros e A ATP-agaros e Fig Preparation of ITP-agarose ATP-agarose were incubated in M HCl ... graph) or after (lower graph) deamination, and the bases released were analyzed by HPLC The peaks indicated by an open arrowhead and a closed arrowhead were compared with peaks of standard samples, ... RS21-C6 mRNA by real-time quantitative PCR, and found that RS21-C6 is ubiquitously expressed and that expression was highest in the liver and heart, and to a lesser extent the salivary gland (Fig 3D)...
- 13
- 424
- 0