two additional setproperty actions change the scale of the movie clip using the mysize variable from the text file the pictures at the top show the movie clip called molecule before the user clicks it left and after the user clicks it
Báo cáo y học: "A scale of functional divergence for yeast duplicated genes revealed from analysis of the protein-protein interaction network" doc
... the tree (see Additional data file 2) and evaluated statistically (data not shown), allowing the classification of 38/41 pairs of duplicated genes (Table 1) We then investigated the details of ... deposited research SIR2 GYP5 NMA1 Genome Biology 2004, 5:R76 information + and - indicate the status of the duplicates in respect of their localization in the same PRODISTIN class and whether they ... transcription [21] Other Pho2 partners populate the rest of the class On the other hand, Ace2 partitioned with Mob2 and Cbk1, which form a kinase complex regulating the localization of Ace2 in the daughter...
- 13
- 209
- 0
Báo cáo toán học: " RFTraffic: a study of passive traffic awareness using emitted RF noise from the vehicles" docx
... transportation network with the visual-based systems is not feasible Moreover, the variation of the weather condition affects the performance of traffic cameras severely On the contrary, weather changes ... architecture that requires user interaction in the proposed architecture Correlation of the context attributes to the observed road segment can not be neglected So we limit the definition of context ... part of this work The MATLAB data mining toolboxes [41] are selected for traffic situation recognition because of the portability and domain specific representations of MATLAB programme [42], and the...
- 37
- 347
- 0
báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot
... GGGTTTTGACATACATATTCCATCA GGGTTTTGACATACGTATTCCATCA Os.25255.1.S1 _at (LOC_Os01g25530) P I F S GATCGGCTATATCTATTGTTGCTCT GATCAGCTATATCTATTGTTGCTCT GATCAGCTATATCTATTGTTGCTCT GATCAGCTATATCTATTGTTGCTCT ... CATACTGCTAAAGCTTTTATTATTTTCTATCATTATGATAGCTCTTTTTCTTTTTTGCTTATTCTTTGGTATGATTCTTTGGA CATACTGGTAAAGCTTTTATTATTTTCTATCATTATAATAGCTCTTTTTCTTTTTTGCTTATTCTTTGGTCTGATTCTTTGGA CATACTGGTAAAGCTTTTATTATTTTCTATCATTATAATAGCTCTTTTTCTTTTTTGCTTATTCTTTGGTCTGATTCTTTGGA CATACTGGTAAAGCTTTTATTGTTTTCTATCATTATAATAGCTCTTTTTCTTTTTTGCTTATTCTTTGGTCTGATTCTTTGGA ... opportunities for the identification of additional SFP markers and resolution of trait determinants without additional expenditure on materials or data acquisition Therefore, application of the RPP method...
- 10
- 250
- 0
Negotiating agrarian change livelihood agriculations of the commercial craft peasantry in northern vietnam
... indicate that a variety of relationships exist between the landowners and the landless, in the context of agricultural commercialization Despite this, they still concede the existence of the process ... process of land becoming concentrated in the hands of a small number of landowners, under the process of commercialization For them, the landless are not a victim of commoditization as classical theorists’ ... transitions equate to capitalist transformations Classical theories of agrarian change assert that the penetration of capitalism into the countryside leads inexorably to the polarization of landholdings,...
- 347
- 483
- 0
Tài liệu Telecommuting: will it change the world? Telecommuting will have major effects in the worlds of work pdf
... number of parents believe that it is much better for their children to be educated at home by the people who know them and their needs best This essay will examine the question of home schooling and ... goals at work or in their personal life In conclusion, I feel that we cannot generalize about children or adults being better learners It depends on the situation and the motivation of the person, ... many skills that compensate for the decline in the ability of the brain to grasp and remember new material They can organize their learning by setting times for reading or practice They can build...
- 9
- 660
- 0
Tài liệu APICE: Common Mediterranean strategy and local practical Actions for the mitigation of Port, Industries and Cities Emissions pdf
... implications for policy and other users An important feature of the conference is that it brings together scientists and other stakeholders from the air pollution, climate change, policy and health ... identified on the basis of the outputs of the monitoring campaigns using the worldwide most advanced statistical tools as Chemical Mass Balance (CMB) and/ or the Positive Matrix Factorization (PMF) ... pollution in the port cities involved in APICE (Barcelona, Marseille, Genoa, Venice and Thessaloniki) It this framework, the air quality status of the five port cities has been analyzed, with a...
- 4
- 452
- 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt
... numbers over the diagrams indicate the position of the corresponding nucleotides relative to the translation start site, and the numbers in parentheses below the diagram show the position of the corresponding ... nucleotide positions relative to the transcription starting site of exon Constructs are shown in the left- hand panel; construct names are given at the left of the bar and the locations of the inserted ... found using TRANSFAC software and are indicated by overbars The underlines represent the locations of the two oligonucleotide probes used for further analysis The position and identity of mutations...
- 12
- 609
- 0
Báo cáo "QUATERNARY GEOLOGICAL MAP OF THE CONTINENTAL SHELF OF VIETNAM AT THE SCALE OF 1:1,000,000 " potx
... coastal sandy platforms and sandy bars in the central part of Vietnam, the sandy bodies in the Cuu Long Delta as well as Red River Delta that marked the highstand and lowstand water level during the ... Vu The selection of scale of the map is very important for interpretation and performance of geological formation on the map Stratigraphical boundaries in Quaternary are divided by comparison the ... depth from -3000m to -3500m and on the outer margin The provenance of them are mainly from terrigenous materials carried out from paleoriver with fragments and volcanic mud Their common feature...
- 10
- 404
- 0
BONDS AND CLIMATE CHANGE THE STATE OF THE MARKET IN 2012 pdf
... investors concerned with the macro risks of climate change From this report, key priorities would be the waste and water sectors Aggregate to scale and index Tapping the institutional investment ... “Recognising the extent of the climatethemed bond universe will help investors appreciate the scale and liquidity available.” www.climatebonds.net © Published by the Climate Bonds Initiative May ... biofuels, hydro, waste and water More transparency from issuers could bring some of these into the climate-themed bond universe Calculated as of February 2012 with only amounts outstanding from...
- 8
- 478
- 0
Báo cáo khoa học: Different roles of two c-tubulin isotypes in the cytoskeleton of the Antarctic ciliate Euplotes focardii Remodelling of interaction surfaces may enhance microtubule nucleation at low temperature doc
... and elongation between the two genes, and ⁄ or from variation in the rates of degradation of the two messages To test the first hypothesis, the gene copy number of c-T1 and c-T2 was estimated by ... [12,35] and that the residue substitutions and conformational changes at the plus-end facilitate longitudinal interaction with the a-tubulin subunit located at the minus-end of the tubulin heterodimer ... c-T1 and c-T2 Figure shows the superimposition of the 3D structures of c-T1 and c-T2 from the side and the plus end, respectively The comparison demonstrates that the differences between c-T1 and...
- 16
- 467
- 0
Báo cáo khoa học: Two short protein domains are responsible for the nuclear localization of the mouse spermine oxidase l isoform pdf
... localization for the mSMOl isoform (Fig 4) Taken together, these results consistently substantiate the hypothesis that these two structural regions are mandatory for the nuclear localization of mSMOl, ... activities were expressed in international units (IU: the enzyme concentration that catalyzed the oxidation of lmol of substrateÆmin)1) per litre of culture broth Protein content was estimated ... different substrates at various concentrations Km and kcat values were determined using Spm as a substrate at concentrations ranging from 50 to 500 lm, at a constant mSMO isoform concentration of 2.0...
- 8
- 413
- 0
Báo cáo khoa học: Two separate regions essential for nuclear import of the hnRNP D nucleocytoplasmic shuttling sequence ppt
... at a low concentration of 0.1–0.2 lm Trn-1 with a high concentration of lm DNS, but not at a high concentration of lm Trn-1 This indicates that the translocation of the substrate–Trn-1 complex ... deletion of the last three C-terminal amino acids KPY, alanine substitution and even point mutation of either of the last two C-terminal amino acids PY completely abolished the in vivo and in vitro ... confirmed the expression of mutant fusion proteins of the expected size of 70 kDa (data not shown), indicating that the cytoplasmic fluorescent signal was not that of a degraded protein These results...
- 13
- 338
- 0
Báo cáo khoa học: Identification of two cysteine residues involved in the binding of UDP-GalNAc to UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) ppt
... membrane The enzymatic activities were correlated with the concentration of recombinant proteins in the media This was done to evaluate the effects of the mutations on both the specific activity and the ... scanning and the intensity of each band was determined using the NIH Image software The enzymatic activity of the P-DN42 and mutant P-DN42 gene products was determined as described below The activity ... glycerol, and 0.1% taurodeoxycholate The enzymatic activity of the samples was determined using the PD-10 assay (see above) To study the influence of UDP-GalNAc or UDP on the effect of PCMPS, the treatment...
- 9
- 435
- 0
Báo cáo khoa học: Change in structure of the N-terminal region of transthyretin produces change in affinity of transthyretin to T4 and T3 pdf
... between these two types of changes The work reported here is a planned quantitative analysis in vitro of the relationship between the two types of changes In a previous report [14], we demonstrated ... the N-terminal region exert a greater influence on the affinity of T4 than on the affinity of T3 This could imply that the core of TTR has a major influence in determining the affinity of T3 and the ... TTRs showed that the recombinant proteins have the relative mobility similar to those of TTRs from other vertebrate species (Fig 4) The subunit molecular masses determined from the calibration...
- 11
- 457
- 0
Control of Dioxins (and other Organochlorines) from the Pulp and Paper Industry under the Clean Water Act and Lead in Soil at Superfund Mining Sites: Two Case Studies in EPA''''s Use of Science potx
... it is part of the vernacular of many of those providing the information and of many of the ultimate users of the study results Figure A presents a simplified model of the fate and transport of ... investigation of the environmental fate of this fraction of the organochlorines is needed to confirm that neither it nor its decomposition products are harmful Dioxin from Pulp and Paper and Lead ... authority to require the pulp and paper sector to provide the data, and noted that the authority supplied the agency “with an arrow in their quiver” during the negotiations The American Forest and...
- 65
- 641
- 0
scientific american - 2004 07 - will gene doping change the nature of sport
... It In the 19th century the Netherlands issued patent after patent that was neither novel nor practical, a situation that would be familiar to anyone in the contemporary U.S patent community The ... side from the gold shunt on the other The density of data storage possible with this read head is determined by the thickness of the indium antimonide (InSb) mesa and the separation of the two ... often from their fathers as the offspring from any of the other three groups The researchers suggest in the May 14 Science that the culprits are microscopic airborne particles of soot and SMOG—...
- 92
- 543
- 0
báo cáo hóa học: " Population norms and cut-off-points for suboptimal health related quality of life in two generic measures for adolescents: the Spanish VSP-A and KINDL-R" pdf
... Description of the instruments and variables The Spanish versions of the VSP-A and KINDL-R were administered together with other demographic and health status variables The VSP-A and the KINDL-R are two ... "Relations with teachers", "School work", "Leisure", and two additional modules that report information on "Relations with health professionals" and on "Sentimental and sexual life" (these two latter ... children and adolescents using the VSP-A and KINDL-R questionnaires The use of cut-off points also help in the interpretation of HRQL scores together with the use of norm values [3,5] The cut-off...
- 9
- 557
- 0
báo cáo hóa học: " Internal construct validity of the Warwick-Edinburgh Mental Well-being Scale (WEMWBS): a Rasch analysis using data from the Scottish Health Education Population Survey" potx
... estimates of the internal construct validity of the scale, the total data set is randomised into two further sets of approximately 50% of cases Final results concerning the validity of the scale ... the time; 1= Rarely; 2= Some of the time; 3=Often and 4= All of the time Figure Threshold map for the 14 item scale Threshold map for the 14 item scale (See additional file for full text of items) ... in its coordination and helped to draft the manuscript SW participated in the coordination of the study and helped to draft the manuscript Additional material Page of (page number not for citation...
- 8
- 462
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25