triangulation during the evaluation of a nursing documentation system background of the study
Báo cáo khoa học: "Incidence of low central venous oxygen saturation during unplanned admissions in a multidisciplinary intensive care unit: an observational study" pdf
... an arterial catheter was in place, an arterial blood sample was taken at the same time for the same analysis Sampling from both sites was repeated six hours later Persons involved in the treatment ... Critical Care Vol 11 No Bracht et al of data, and revised the manuscript All authors read and approved the final manuscript Acknowledgements This study was funded by an institutional grant The authors ... our study a disease of the central nervous system was the leading diagnosis, many of them also had concomitant diseases/injuries Five of the 29 patients in this group had an admission ScvO2 of...
- 8
- 255
- 0
Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx
... offered a personal day structure program made by the nursing staff in collaboration with the recreational therapist Exercise and music therapy can be part of this day program Psycho-education is also ... evaluation of the study MVD assisted in the design of the study and co-wrote the paper ED assisted in the design of the study and the intervention and co-wrote the paper RK assisted in the design of the ... after the diagnosis, the day structure program and behavioral management strategy should be incorporated in regular care The psychologist supervises the recreational therapist and nursing staff...
- 7
- 484
- 0
Tài liệu Evaluation of physical activity programmes for elderly people - a descriptive study using the EFQM’ criteria ppt
... Portugal Authors’ contributions AIM participated in the acquisition and analysis of data and participated in drafting and editing the manuscript MJR managed the data collection and analysis and ... some of the coordinators Other information was gathered from the web page of the organization We used standard approaches to statistical analysis of data including frequencies and percentages ... coordination of the study and supervised the drafting and editing of manuscript JC participated in the design of the questionnaires/interviews and coordination and management of the study All authors...
- 16
- 959
- 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... GACTACTTTGGAGTTTGCGGTCAC AGTTGGGCATTCATCCATCC CAGAAAAAGACAAGGAGGAC ACAACACCACTGCTGCGGAGTTA ACATCAAGGAGCGTTAGAATCTAA GATTTAAGTGGAGCGGAATGCTA TGTGAAACGCAGTCTCTTCC CAAGGAGCGTTAGAATCTAAAG TCTCCAAACCAGATCTCTACAG ... forward forward forward reverse reverse forward reverse forward reverse Name PCR product length (bp) GTGGACGTGATGGAGGATAAG GAAGGCACGCTGAGGAAGAC GGATGAATGCCCAACTTCTCCC ACGAAACCTGGCAGAGTCCAAG GACTACTTTGGAGTTTGCGGTCAC ... arbitrary units (a. u.), the relative content of each mRNAldh a isoform per ng total RNA at each acclimation temperature was quantified (Table 3) At AT ¼ 18 °C the ratio between b mRNAa ldh a and...
- 11
- 662
- 0
Campaigns of a Non-Combatant, and His Romaunt Abroad During the War ppt
... tidings of the retreat to the astonished Federals, and they raised the national flag within the fortifications, in the gray of the morning of the 4th of May Many negroes also escaped the vigilance of ... remnant of the African and the American were to look from their Island Home upon the clash of our armies and the murder of our braves CHAPTER VIII 37 By the 19th of May the skirts of the grand army ... camp had somewhat reduced my enthusiasm, and I already wearied of the damp beds, the hard fare, and the coarse conversation of the bivouac The young lady assented willingly, as she stated that...
- 175
- 443
- 0
Diary of a Nursing Sister on the Western Front, 1914-1915 pptx
... doing all the train half the night, and another all the train the other half The other two go to bed all night I am one of these, as I have got a bit of a throat and have been sent to bed early We've ... was murder." They said the burning hot sun was one of the worst parts They said "the officers was grand"; many regiments seem to have hardly any officers left They all say that the S .A War was ... place is full of rumours of all sorts of horrors, that the Germans have landed in Scotland, that they are driving the Allies back on all sides, and that the casualties are in thousands So far there...
- 98
- 617
- 0
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx
... Allagash Allagash Allagash Allagash Canadaigua silt loam, thin solum Caribou Caribou Caribou Caribou Caribou Caribou Caribou Conant silt loam Conant silt loam Conant silt loam Daigle silt loam ... fine sandy loam Madawaska fine sandy loam Madawaska fine sandy loam Made land Mapleton shaly silt loam Mapleton shaly silt loam Mapleton shaly silt loam Mixed alluvial land Monarda and Burnham silt ... the town of Grande Isle to the town of Hamlin The two areas were delineated as the research site because they are areas that contain all four of the data sources The surface area is approximately...
- 131
- 599
- 0
Báo cáo khoa học: "QARLA:A Framework for the Evaluation of Text Summarization Systems" pdf
... framework, QARLA, that addresses such issues Given a set of manual summaries and another set of baseline summaries per task, together with a set of similarity metrics, QARLA provides quantitative measures ... similarity metrics to compare summaries An evaluation framework should include, at least: • A measure QM,X (a) ∈ [0, 1] that estimates the quality of an automatic summary a, using the similarity ... Limits of N-Gram Translation Evaluation Metrics In Proceedings of MT Summit IX, New Orleans,LA Luke Shen Joseph P Turian and I Dan Melamed 2003 Evaluation of Machine Translation and its Evaluation...
- 10
- 517
- 0
Báo cáo khoa học: "A Figure of Merit for the Evaluation of Web-Corpus Randomness" ppt
... a basic Japanese vocabulary list Both Sharoff and Ueyama and Baroni evaluated the results through a manual classification of the retrieved pages and by qualitative analysis of the words that are ... b1 The mean Euclidean distance between (ai , bi ) pairs is a value between and h, the length of the diagonal of the rectangle which is the union of A and B Instead of drawing pairs we can draw ... for the fact that over 100 documents in the 3esl subcorpus pertained to the rather narrow domain of aviation and space travel, while no comparably narrow topic had such a large share of the distribution...
- 8
- 436
- 0
Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs. Adams pot
... Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Abigail Adams During the Revolution, by John Adams and Abigail Adams and Charles Francis Adams ... online at www.gutenberg.net Title: Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs Adams Author: John Adams Abigail Adams Charles Francis Adams ... solitary meditation, Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam the confidential whisper to a friend, never meant to reach the ear of the multitude,...
- 269
- 350
- 0
Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs. Adams potx
... Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Abigail Adams During the Revolution, by John Adams and Abigail Adams and Charles Francis Adams ... online at www.gutenberg.net Title: Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs Adams Author: John Adams Abigail Adams Charles Francis Adams ... solitary meditation, Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam the confidential whisper to a friend, never meant to reach the ear of the multitude,...
- 269
- 481
- 0
A POPULAR HISTORY OF ASTRONOMY DURING THE NINETEENTH CENTURY pot
... Mayer actually attempted the analysis, but without result On the 13th of August, 1596, David Fabricius, an unprofessional astronomer in East Friesland, saw in the neck of the Whale a star of the ... an idea of the arduous nature of this task It involved the formation of a theory of the errors of each of Bradley's instruments, and a difficult and delicate inquiry into the true value of each ... observer of the heavens The greatest of modern astronomers was born at Hanover, November 15, 1738 He was the fourth child of Isaac Herschel, a hautboy-player in the band of the Hanoverian Guard, and...
- 663
- 438
- 1
DELIVERING HEALTH EDUCATION VIA THE WEB: DESIGN AND FORMATIVE EVALUATION OF A DISCOURSE-BASED LEARNING ENVIRONMENT pot
... user name and password As such, during full implementation of the formative evaluation, the access control database contained at least as many users as it would during implementation of the Web ... experienced while navigating through the site A suggested enhancement to the navigational capability of the site was a text-based replication of site navigation bar at the top of each page to make scrolling ... Web learning environment These icons were replicated at the top left corner of the corresponding page and again in a navigational menu bar that appears at the bottom of each page allowing the student...
- 12
- 411
- 0
Perioperative Care of the Child A Nursing Manual ppt
... Western Australia, Australia, and is an Honorary Professor in the Department of Paediatrics and Child Health, The University of Queensland, Brisbane, Queensland, Australia She maintains a small clinical ... have a minimal risk of post-operative haemorrhage, a minimal risk of post-operative airway compromise and controllable pain that can be managed with oral analgesics at home (Australia New Zealand ... Shields and Ann Tanner Preparation of children for theatre Children and their parents going into theatre are often anxious about their surgery and many have little idea of the actual procedure The...
- 290
- 813
- 0
Báo cáo khoa học: "A machine learning approach to the automatic evaluation of machine translation" potx
... shows the effect of varying the size of the training data The data point graphed is the average accuracy over the ten samples at a given sample size, with error bars showing the range from the least ... consider the advantages and possible uses of this automatic evaluation methodology 5.1 Advantages of the approach Once an appropriate set of features has been selected and tools to automatically ... measured the following constituent sizes: maximal and average NP length maximal and average AJP length maximal and average PP length maximal and average AVP length sentence length On a lexical...
- 8
- 393
- 0
Báo cáo khoa học: "A Quantitative Evaluation of Linguistic Tests for the Automatic Prediction of Semantic Markedness" potx
... comparisons of quantitative variables was in most cases straightforward, and always at least plausible The analysis of the linguistic tests and their combinations has also led to a computational method ... We have presented a quantitative analysis of the performance of measurable linguistic tests for the selection of the semantically unmarked term out of a pair of antonymous adjectives The analysis ... automatically extracts the relevant data for these tests from text corpora and corpora-based databases, and use this system to measure the applicability and accuracy of each method We apply statistical tests...
- 8
- 442
- 0
báo cáo hóa học: " A psychometric evaluation of the PedsQL™ Family Impact Module in parents of children with sickle cell disease" pptx
... United States Census classification and reflect parent report based on the following choices: White, Black, Native Hawaiian or Other Pacific Islander, Asian, American Indian or Alaskan native, Other ... supervision and interpretation of data analysis, and revised the manuscript NP aided in study design, analyzed and interpreted the data, and revised the manuscript Acknowledgements This work was supported ... items in the emotional, social, and school functioning scales The physical health summary score is comprised of the average of items in the physical functioning scale and is the same score as the...
- 11
- 552
- 0
báo cáo hóa học: " Evaluation of the reliability and validity of the Medical Outcomes Study sleep scale in patients with painful diabetic peripheral neuropathy during an international clinical trial" pot
... pain) At the end of the baseline phase, a mean of the daily pain scores was calculated; patients with score of or higher were randomized at visit (V2) and started the treatment phase During the ... that as patients are being treated, most of the patients classified as stable are actually minimally improved It also suggests that pain and the other factors, taken individually, can not be the ... dimension of the Australian, Hungarian and UK English versions, and item of the South African, item of the "somnolence" dimension of the German and South African and item of the "sleep disturbance"...
- 12
- 553
- 0
Tìm thêm: khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25