treating consciousness as a variable the fading taboo
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
... used to analyse the associations between the risk factors and the outcome variable The analysis was performed in three stages: initially, analysis was performed to establish the association between ... cases overwrite the codes when the information is updated Disability pension though, always has the higher priority In the present study we have analysed the determinants measured using the baseline ... health behaviour The third and final step introduced the psychosocial and physical work environment variables The Cochran-Armitage trend test was performed in order to test if a gradual increase...
- 6
- 578
- 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
... Medical Association Influenza was not a reportable disease: the only evidence of the early occurrence was the registration of deaths reported as uncomplicated cases of pneumonia by physicians to various ... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza ... transmission disease There are two major classes of influenza virus, type A and B these two classes have similar structures, but all A virus proteins are different from B as far as the immune system...
- 4
- 520
- 0
Vcd as a stimulating factor to increase the young learners’ time-on-task
... for the past few decades So many approaches and methods such as Audiolingual Method, Total Physical Response, Content-based language teaching, Theme-based language teaching have been advanced, ... (2005), the oral-situational approach is based on a behaviorist learning theory, that is, it assumes that language learning is habit formation and over learning Grammatical structures are carefully ... teaching approaches: the oral-situational approach, the notional-functional approach, and the communicative approach, which are based on the three above language theories, respectively According...
- 45
- 516
- 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
... first and half ate the heightened aroma samples first The subjects were asked to rate one sample a day at any time of the day they wanted Similarly to the tasting sessions, As the final task in the ... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... PEA) and liking of the vanilla beverage at any phase of the study The aim of the present study was to examine the effects of heightened aroma concentration on the pleasantness and intake of a...
- 10
- 599
- 1
Reading Theory as a Microcosm of the Four Skills
... central Even with as few details as we have outlined above, there are certain things that we can assume about this group First, given their age group, it is reasonable to assume that many of them ... seen how the only difference is in their emphasis It is my belief that in giving the L2 student both as much input and practice as they can reasonably manage, and a strong metalinguistic awareness, ... teachers as they are the backbone of many schools in Ireland and Britain One of the most important initial tasks for any teacher is the task of knowing his clients The notion of needs analysis is absolutely...
- 5
- 680
- 0
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
... its application are completely unrelated to those set forth in the registration cited as a bar to registration of applicant’s mark The Examining Attorney was not persuaded by applicant’s arguments, ... instituted the appeal and both applicant and the Examining Attorney filed briefs Applicant did not request an oral hearing before the Board Accordingly, we have considered this appeal based on the written ... in the application and the written arguments presented in the appeal briefs After careful consideration of these materials, we hold that the refusal to register must be affirmed As applicant...
- 8
- 416
- 0
Tài liệu Exporting the Results of a Query as a String docx
... is the TAB character rowDelimiter The character or characters that separate rows The default value is the CARRIAGE RETURN character nullExpr A string that is substituted for null column values ... If a number larger than the number of records in the table is specified, all records are converted without error columnDelimiter The character or characters that separate columns The default value ... corresponding to the rows selected from the table dt The DataTable to convert to a string numRows The number of rows in the table to convert If this number is negative, all rows in the table are converted...
- 4
- 388
- 0
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx
... monogenism and polygenism Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth Eurafrica, Austafrica, Asia, America, ... Special Archæology Egyptian, Assyrian, Phenician, Classical, and Medieval Archæology Archæology of the various areas in America Art in stone, bone, shell, wood, clay, paper, etc., in these areas ... languages Universal alphabets Logical relations of the parts of speech The vocabulary and the grammar of languages Distinctions between languages and dialects Mixed languages and jargons Relations...
- 28
- 665
- 0
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt
... Searches in databases Using the putative C-terminal domain of C fluminea as a query, sequence databases were searched by blastp and tblastn for the occurrence of domains similar to the P haloplanktis ... et al The species assayed by PCR were the chiton Acantochitona sp (Mollusca, Polyplacophora) and the oyster Crassostrea gigas (Mollusca, Bivalvia) Sequence data were deposited in GenBank (Table ... in all animals and in some rare bacteria [11,12] They are nonmodular, consisting of a single globular catalytic domain, with the noticeable exception of the a- amylase from the bacterium Pseudoalteromonas...
- 8
- 624
- 0
Tài liệu Interest on Excess Reserves as a Monetary Policy Instrument: The Experience of Foreign Central Banks ppt
... case studies that form the basis for the findings The eight central banks covered are: the Reserve Bank of Australia, the Bank of Canada, the Bank of England, the European Central Bank, the Bank ... deposits in the facility was initially set at 100 basis points below the official repo rate, which was the main policy rate at the time, whereas the rate charged in the lending facility was 100 basis ... central bank balances and the short-term market rate is allowed to trade at a level close to the policy rate floor These five are the ECB, the Bank of Japan, the Bank of England, the Bank of Canada,...
- 49
- 653
- 0
Tài liệu The Man of Letters as a Man of Business docx
... and it was not till the Sunday editions of the great dailies arose that there was any real hope for the serial in the papers I suspect that it was the vast demand for material in their pages twelve, ... when they can get the work Their incomes are mainly from serial publication in the different magazines; and the prosperity of the magazines has given a whole class existence which, as a class, was ... sure that the case is in every way improved for young authors The magazines all maintain a staff for the careful examination of manuscripts, but as most of the material they print has been engaged,...
- 21
- 544
- 0
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc
... for the endopeptidase activity of cathepsin B, as well as that endopeptidase activity should be associated with the occluding loop displacement from the active site cleft Recently, the Cathepsin ... loop is rather flexible and will adapt to structural features of the inhibitors as well as to the packing constraints of the environment The larger and wider the features of the ligands that compete ... (cathepsin C): exclusion domain added to an endopeptidase framework creates the machine for activation of granular serine proteases EMBO J 20, 6570–6582 18 Molgaard A, Arnau J, Lauritzen C, Larsen...
- 8
- 632
- 0
Tài liệu Huntington’s Borghese Style Urn as a Study of Two-Dimensional Art & The Production of a Piece of Two-Dimensional Art pptx
... aesthetic The science of the “beautiful” in a work of art The aesthetic appeal of a work of art is defined by the visual Social, ethical moral, and contemporary standards of a society armature A ... Compare the "god-like" qualities of a particular character (such as Diana, goddess of the hunt) to a modern character (such as Mia Hamm, huntress of a soccer goal) The Huntington Library, Art ... stick and two baseballs on the other—balancing out the picture balance A principal of art and design concerned with the arrangement of one or more elements in a work of art so that they appear symmetrical...
- 6
- 681
- 0
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc
... MS analysis and assay-directed fractionation [83] It has subnanomolar potency at the a3 b2 nAChR and is 200-fold less active on the a7 nAChR (Table 1) AnIB is sulfated at tyrosine 16 and has, ... to mutation in PnIA again caused an increase in potency as arise primarily from a3 b2 and a3 b4 nAChRs Activity on well as a shift in selectivity: while PnIA inhibited an a- BTXa7 nAChRs was excluded ... acts at somatodendritic nAChR in the substantia nigra pars compacta and at presynaptic nAChR in the striatum (B) a- Conotoxin MII was one of the first antagonists that differentiated pharmacologically...
- 15
- 757
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were ... Hillerød, Denmark), treatment with T4 DNA ligase (Fermentas) and shrimp alkaline phosphatase (Fermentas) were carried out as prescribed by the manufacturers DNA fragments were purified from agarose gels...
- 12
- 616
- 0
Tài liệu The Value of the Case Study as a Research Strategy doc
... research programme: It is for this reason that researchers like Yin are especially adamant that a case database be created and maintained to \allow repetition and re-evaluation of cases Reliability ... important during the data collection phase, and involves the use of case study protocol as well as the case study database already mentioned Validity and reliability can thus be built into a case ... that the application of the methodology is as likely (perhaps inherently) at fault as the methodology itself Qualitative research as preparation - As mentioned above, qualitative research has a...
- 15
- 587
- 0
Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx
... important to ascertain how much language they are using at home If necessary use a bilingual worker to talk with the family and establish what language the child speaks at home, ask the family ... each child Assessment of learning includes reviewing, gathering and analysing information about what the learner can do, what they understand and the progress they are making at any particular ... achieving the outcomes Learners as individuals will follow different pathways to achieving these outcomes Standard Australian English is the national language of Australia and it is essential that all...
- 31
- 1,043
- 2
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... of Anesthesia and Director of the Mother and Child Anesthesia Unit at the Hadassah–Hebrew University Medical Center He is a past Chair of the Israel Association of Obstetric Anesthesia His main ... 3) There was no clear relationship between the anesthesia workforce allocation to the labor ward and the obstetric anesthesia workload as measured by the OAAI (Figure 4) Figure Correlation of annual ... Obstetric anesthesia workload demand in Israel has increased due to both an increase in the requests for labor analgesia and a marked increase in the cesarean delivery rate We propose a new workload-driven...
- 14
- 610
- 0
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt
... had a picomolar LOAEL in the ciliary beat frequency assay Many of the compounds in Table were also screened using a chick chorioallantoic membrane (CAM) assay that measures growth of the CAM and ... oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... femtomolar range (Table 1) In general, if a chemical were inhibitory, it acted in all three bioassays, although the potency and efficacy for a particular chemical varied among the assays Some of the...
- 17
- 733
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS The oligonucleotide ... base and on the cytoplasmic ring, respectively Height indicates the vertical distance between the NPC cytoplasmic surface and the base Scale bar = 50 nm (D) The outer diameter was measured and...
- 12
- 454
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25