trauma with a skull defect that requires reconstruction how can this best be managed
Báo cáo khoa học: "GIST suture-line recurrence at a gastrojejunal anastomosis 8 years after gastrectomy: can GIST ever be described as truly benign? A case report" pdf
... this article as: Papalambros et al.: GIST suture-line recurrence at a gastrojejunal anastomosis years after gastrectomy: can GIST ever be described as truly benign? A case report World Journal ... tumours [6,7,10] The American Joint Committee on Cancer (AJCC) has created a similar scheme but also incorporate advanced and metastatic GISTs [13] The latest risk scheme has recently been published ... sporadically and that there were no clinical findings suggestive of familial GIST which can be seen in patients with neurofibramatosis type (NF1) or in the Carney-Stratakis dyad Conclusions The significant...
- 4
- 284
- 0
Tài liệu Báo cáo Y học: Ornithine decarboxylase-antizyme is rapidly degraded through a mechanism that requires functional ubiquitin-dependent proteolytic activity pot
... proteasome However, in contrast with the degradation of ODC that requires interaction with antizyme, the degradation of antizyme may occur without interacting with ODC We also demonstrate that ... antizyme is a rapidly degraded protein and that as with ODC, the degradation of antizyme is also carried out by the proteasome Antizyme mRNA contains two variably used in-frame initiation codons ... 689–697 26 Matsufuji, S., Miyazaki, Y., Kanamoto, R., Kameji, T., Murakami, Y., Baby, T.G., Fujita, K., Ohno, T & Hayashi, S (1990) Analyses of ornithine decarboxylase antizyme mRNA with a cDNA cloned...
- 7
- 382
- 0
Panorama: A Database System that Annotates Its Answers to Queries with their Properties potx
... either an x or a y or a constant, and θ is a comparator (e.g., , ≥, =, =) In particular, each x and each y must appear at least once among the zs PANORAMA: A DATABASE SYSTEM THAT ANNOTATES ... information is extracted, database values may gain additional meaning Thus, a database query may be answered both extensionally (the usual answer), and intensionally (a set of characterizations) A ... 3.2 PANORAMA: A DATABASE SYSTEM THAT ANNOTATES ITS ANSWERS 63 In addition, Panorama extends the query language with three statements to manipulate and query the meta-database To add a new property...
- 23
- 332
- 0
Báo cáo khoa học: Glycolipids with nonreducing end a-mannosyl residues that have the potential to activate invariant Va19 NKT cells pptx
... such as a- galactosyl ceramide (a- GalCer) [4] isolated from marine sponge [5], a- glucuronosyl ceramide and a- galacturonosyl ceramide from a- proteobacteria [6,7], and intracellular lysosomal isoglobotriaosyl ... Okamoto N, Kanie O, Huang Y-Y, Fujii R, Watanabe H & Shimamura M (2005) Synthetic a- mannosyl ceramide as a potent stimulant for a novel NKT cell repertoire bearing the invariant Va19-Ja26 TCR a ... Miyazaki for providing valuable materials They thank Mr S Kamijo and his group members for taking care of the mice They also thank Ms N Suzuki and Ms Y Murakami for technical and secretarial assistance...
- 12
- 370
- 0
Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx
... CTCCAGACAGCCGCCTGGTTAGC CACACCCTGTAGAGGGCTCTCCAG CCTTTCTTATCAGCCACCCTGTAGAG GGAATACAGCTGGCAAGGC TGATCCTGGGCGTATGCGC GCCCCAACTAATGCATTGGTCACTAG CCAAGCAGTCGCATTGGCCCC a The altered nucleotides on the PMV cDNA are ... blotted, and probed for PMV accumulation with a 32Plabelled cDNA that detects genomic (g) and subgenomic (sg) RNA Proteins were separated via SDS-PAGE and probed with rabbit polyclonal antiserum against ... P31 7A- 989R N32 3A- 1007R L32 5A- 1014R REP/Y -A 1044R-C /A REP/F -A REP/D -A MUTPMV-1236R REP/W -A CCCCAGCGGCTTCGTTCTTTGC GGAACCCCAGCAAACTCGTTCTTTGC CTGTGGGTTTTGCAACCCCAGCG CAGCCAACTGGGCAGCCTCTGTG CTCCAGACAGCCGCCTGGTTAGC...
- 12
- 307
- 0
báo cáo khoa học: "Immediate breast reconstruction with a saline implant and AlloDerm, following removal of a Phyllodes tumor" pdf
... Vascularization of the nipple and areolar are not disturbed with this incision [20] This incision is best for smaller breast with low ptosis as it may be difficult to reach parasternal and subclavicular ... nipple-sparing mastectomy The superior or inferior periareolar with lateral extension, transareolar with perinipple and lateral-medial extension, transareolar and transnipple incision with medial and ... for a young patient with a comparatively large tumor mass Although LD with an implant was thought to be the best choice for breast reconstruction, the patient opted for just a saline implant with...
- 5
- 453
- 0
báo cáo khoa học: "Blunt cerebrovascular trauma causing vertebral arteryd issection in combination with a laryngeal fracture: a case report" ppsx
... 39:1232-1241 Veras LM, Pedraza-Gutierrez S, Castellanos J, Capellades J, Casamitjana J, Rovira-Canellas A: Vertebral artery occlusion after acute cervical spine trauma Spine (Phila Pa 1976) 2000, ... vertebral artery injury and a laryngeal fracture For vertebral artery injuries, early CT scanning and frequent reassessments are recommended Most patients can be treated with anti-coagulants The ... Brega KE, Franciose RJ, Burch JM: Blunt carotid arterial injuries: implications of a new grading scale J Trauma 1999, 47:845-853 Spaniolas K, Velmahos GC, Alam HB, de Moya M, Tabbara M, Sailhamer...
- 3
- 230
- 0
báo cáo khoa học: "Reconstruction of a traumatic duodenal transection with a pedicled ileal loop: a case report" potx
... stable patients with blunt abdominal trauma, and provides excellent anatomic detail of the retroperitoneum However, CT scanning cannot always distinguish Kambaroudis et al Journal of Medical Case ... deteriorated His abdominal pain increased at this time An abdominal computed tomography (CT) scan without contrast agent administration was subsequently performed This revealed a retroperitoneal haematoma ... demarcated and not compatible with a pseudocyst The consensus was that these were manifestations of pancreatitis The antibiotic treatment was changed from intravenous ampicillin/sulbactam grams...
- 6
- 144
- 0
Báo cáo y học: "Reconstruction of the urethra with a Surgisis onlay patch in urethral reconstructive surgery: two case reports" pdf
... Retrograde urethrography revealed a recurrent urethral stricture, as shown in Figure 2A Case 2: Thirty-eight years before presentation, this 55-yearold Caucasian man had undergone an open urethral reconstruction ... described, and various types of autologous materials have been used in order to bridge urethral defects [1] In some cases, the search for new applicable materials became mandatory because of the ... today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach us something www.casesnetwork.com Page of (page number not for citation...
- 4
- 292
- 0
Báo cáo y học: "Characterization of an H3N2 triple reassortant influenza virus with a mutation at the receptor binding domain (D190A) that occurred upon virus transmission from turkeys to pigs" potx
... RBD (Asp to Ala) was generated using QuikChange® Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA) based on manufacture protocol In addition, we generated a virus with a mutation at residue ... epithelial cells Primary human tracheal/bronchial epithelial cells (HAEC) were purchased from Cell Application (Cell Application, San Diego, CA) and were maintained in tracheal/bronchial epithelial ... hemagglutinin inhibition (HI) test was employed to evaluate the cross reactivity between parental (190Asp) and HA-mutant (190Ala) TK04 viruses Additionally, cross reactivity was evaluated between...
- 7
- 512
- 0
Báo cáo y học: "The ‘off-hour’ effect in trauma care: a possible quality indicator with appealing characteristic" pps
... care could then become models for others to copy Another advantage is that this QI can be calculated at the local level (trauma center, trauma system or geographical region) without complex benchmarking ... GJ, Wahl WL, Kim HM, Maier RV: Effect of Patient Load on Trauma Outcomes in a Level I Trauma Center J Trauma 2005, 59:815-8 Di Bartolomeo Scandinavian Journal of Trauma, Resuscitation and Emergency ... hospitals/ systems and those of aftertime in others Thus, the QI should be adapted accordingly The feasibility of an indicator is an important aspect This is because ‘measures based on data that are...
- 4
- 175
- 0
Báo cáo y học: "Injury severity and serum amyloid A correlate with plasma oxidation-reduction potential in multi-trauma patients: a retrospective analysis" pptx
... the amount of day-to-day variability in the ORP electrode Plasma ORP was measured for all collected plasma samples for each patient SAA LCMS analysis All collected plasma samples from trauma patients ... of SAA were calculated using an advanced, proprietary MS integration software package developed in-house The areas were added to give a total SAA area Statistical analysis Patient demographics, ... Plasma ORP measurements Plasma ORP was measured in all collected plasma samples An ORP maximum was assigned to the plasma sample with the highest ORP value for a particular patient Table 1: Patient...
- 7
- 298
- 0
Báo cáo y học: "Natural antisense transcripts with coding capacity in Arabidopsis may have a regulatory role that is not linked to double-stranded RNA degradation" ppt
... A B′ Figure thaliana A comparison of the arrangements of overlapping gene pairs in Arabidopsis A comparison of the arrangements of overlapping gene pairs in Arabidopsis thaliana A and A' label ... Jotham J, May S: NASCArrays: a repository for microarray data generated by NASC's transcriptomics service Nucleic Acid Res 2004:D575-D577 NASCA Arrays: Affymetrix ATH1 arrays database [http:// affymetrix.arabidopsis.info/narrays/experimentbrowse.pl] ... natural antisense transcripts (NATs) that may act as regulators of the sense gene In addition to NATs being transcribed from the same locus as the sense transcript (cis-NATs), NATs can be transcribed...
- 10
- 234
- 0
Drawing - Fun With A Pencil
... know, to start this book, is how to draw a lopsided ball Whatever shape you draw can be used as a foundation for a funny face Do the best you can, even if the ball looks more like a potato 14 THE ... methods This is valuable in caricature You can trace a photo, and draw from the tracing, or take any of your own drawings and distort them Here again is a chance for your own invention Draw a square ... start with a form anything like the skull, or make any allowance for the variety of shapes 36 After this book was published, I learned with interest that a similar basic head form has been used...
- 123
- 1,965
- 6
How to setup a Linux system that can boot directly from a software RAID
... replace the failed one is available it can be installed into the system, partitioned to have the two software RAID partitions to replace the ones of the failed drive The new partitions can be added ... disks already contains data, make a backup if needed (all existing data of partitions involved in the process will be lost), and delete or resize existing partitions to create space for the software ... system is ready to run The raid devices are up and running, and can be checked looking at /proc/mdstat and using mdadm command Before setting up GRUB, the resync of the RAID devices must be completed,...
- 14
- 567
- 1
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"
... Federation notation), as well as with the presence of an impacted supernumerary tooth (distomolar 4.9) The patient reported localized pain and a slight homolateral submandibular lymphadenopathy, without ... investigation and after the assessment of 380 radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Scan (Fig 6) of the inferior maxillary bone Exodontia led to remission of the algic ... tuberculate, supplemental and odontome; however, the Literature also reports a classification according to intraoral position of the supernumerary teeth: Mesiodens; Paramolar; Distomolar and Parapremolar...
- 7
- 597
- 0
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"
... bupivacaine with or without Sarapin Group II = bupivacaine and steroids with or without Sarapin WC = Workers compensation MVA = Motor vehicle injury Analysis of Data Numbers Analyzed Data were analyzed ... results have been reported.64,65 The basis for intraarticular injections has always been that inflammation is present, and that steroids should be used to treat the inflammation However, with lumbar ... C-fibres Acta Anaesthesiol Scand 1990; 34: 335-8 69 Pasqualucci A, Varrassi G, Braschi A, et al Epidural local anesthetic plus corticosteroid for the treatment of cervical brachial radicular pain:...
- 12
- 669
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... statistically significant Presented data are shown as mean ± SEM, unless otherwise CSF Levels of Vgf correctly diagnose ALS and associates with clinical severity Quantitative ELISA assay revealed ... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... suggesting that sporadic ALS patients can be hypermetabolic with decreased fat mass,[25] a phenotype resembling that found in mutant G9 3A- SOD1 ALS mice.[3] We found that exogenous viral expression...
- 8
- 499
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25