traffic on a single interface
iec 60332-1 tests on electric cables under fire conditions - test on a single vertical insulated
... non-governmental organizations liaising with the IEC also participate in this preparation The IEC collaborates closely with the International Organization for Standardization (ISO) in accordance with conditions ... ộgalement aux travaux La CE1 collabore ộtroitement avec l'organisation lpternationale de Normalisation (ISO), selon des conditions fixộes par accord entre les deux organisations 2) Les dộcisions ... organisation mondiale de normalisation composộe de l'ensemble des comitộs ộlectrotechniques nationaux (Comitộs nationaux de la CEI) La CE1 a pour objet de favoriser la coopộration internationale...
- 23
- 498
- 1
iec 60332-2 tests on electric cables under fire conditions - test on a single small vertical insu
... insulations and sheaths of electric cables and cords (elastomeric and thermoplastic compounds) Comparative information on I E C and North American flexible cord types Mineral insulated cables and ... Révision de la présente publication Revision of this publication Le contenu technique des publications de la C E I est constamment revu par la Commission afin d'assurer qu'il reflete bien l'état actuel ... température ambiante avant l'essai Conditions d'essai L'échantillon e s t tendu e t accroché en position verticale a u centre de l'écran métallique ( v o i r article 3, point c)) Une charge de...
- 13
- 402
- 1
Tài liệu ADC’s HDSL Interface Panel combines HDSL termination, DSX-1 and DSX-3 into a single shelf doc
... splitters can be preinstalled or ordered separately ADC Fiber Distribution Hub – ACE-200 (576 Homes) Front of cabinet Rear of cabinet Base Cabinet Sizes Cabinet AFD ACE-100 ACE-200 ACE-400 Size ... specifications by contacting our headquarters office in Minneapolis ADC Telecommunications, Inc views its patent portfolio as an important corporate asset and vigorously enforces its patents Products ... Parking-lot available with terminators • Parking-lot feature provides cross-connect functionality at interconnect price • Parking-lot feature ensures connector cleanliness is maintained • 1x4,...
- 4
- 242
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors Journal compilation ê 2009 FEBS M Banerjee ... 45 Gunasekaran K, Ramakrishnan C & Balaram P (1996) Disallowed Ramachandran conformations of amino acid residues in protein structures J Mol Biol 264, 191198 46 Jia Z, Vandonselaar M, Quali JW ... Borchert TV, Abagyan R, Jaenicke R & Wierenga RK (1994) Design, creation, and characterization of a stable, monomeric triosephosphate isomerase Proc Natl Acad Sci USA 91, 15151518 15 Casal JI, Ahern...
- 15
- 635
- 0
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx
... resolution of the transition state dynamics of a chemical reaction obtained using forceclamp techniques makes a novel contribution to our understanding of protein based chemical reactions Conclusions ... increase in the reduction rate can be explained by an elongation of the disulfide bond by DxR = 0.37 Æ 0.04 , at the transition state of the SN2 chemical reaction Remarkably, the measured distance ... tris(2-carboxyethyl)phosphine (TCEP), a larger bond elongation of Dx = 0.41 Æ 0.04 at the transition state of the reaction was measured (Figure 10 B), in agreement with quantum mechanical calculations...
- 12
- 553
- 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
... transcription was calculated from the ratios of signals for transporter mRNA and GAPDH mRNA With OCT1, OCT2, and CAT4 both vectors were analyzed alongside on a single blot OCT, organic cation transporter; ... Grundemann ¨ unpublished results) For pEBTet ⁄ SLC2 2A1 6h, the 5¢ interface is GGTACC CCCCCGGA; the 3¢ interface is ATGCCTGC GGGGATCCAC TAGTAACGGC CGCC AGTGTG CTGGAATTCT GCAGATATCC ATCACAC TGGCGGCC ... K, Kanai M, Saya H, Kozu T & Berns A (2001) A novel tetracycline-dependent transactivator with E2F4 transcriptional activation domain Nucleic Acids Res 29, E23 14 Ivanova L, Brandli J, Saudan...
- 8
- 331
- 0
Báo cáo hóa học: " Si nanowires by a single-step metal-assisted chemical etching process on lithographically defined areas: formation kinetics" docx
... formed on the blank Si wafer and on lithographically defined areas Cross-sectional SEM images of SiNWs fabricated on non-patterned Si areas (a) and on 100 × 100-μm2 lithographically defined areas ... formation rate of SiNWs on non-patterned and on lithographically defined areas Arrhenius plots of the etch rate of Si by MACE as a function of temperature in the case of non-patterned areas (dark ... stays constant all along the surface Figure A schematic representation and SEM images of SiNWs formed on the confined area (a, b, c) show the process flow for SiNW formation by MACE on the confined...
- 8
- 395
- 0
Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc
... 3a in the plan determined by H atoms, absorbed Ag atom, Si corner adatom and the rest atom Figure 3c reveals that the charge depletion and accumulation mainly occur between the Ag atom and near ... clean Si substrate, 19H-Si(111)- and isolated H atoms are calculated with the same lattice parameters and atomic positions as the relaxed Ag adsorbed 19H-Si(111)-7 surface This allows the charge ... initio simulation package (VASP) [31] Ab initio density functional calculations of surfaces and interfaces play a critical role in providing a nanoscopic understanding of the chemical bonding in these...
- 6
- 368
- 0
Báo cáo y học: "Off-pump occlusion of trans-thoracic minimal invasive surgery (OPOTTMIS) on simple congenital heart diseases (ASD, VSD and PDA) attached consecutive 210 cases report: A single institute experience" doc
... pulmonary calcification, inflammation, or hypertension MV: mitral valve; ABE: acute bacterial endocarditis SVC: superior vena cava; IVC: inferior vena cave; CS: coronary sinus Guo et al Journal ... sever AV prolapse and regurgitation; Muscular VSD affecting cardiac hemodynamic PDA Fistular PDA; Fenestrae PDA; Infundibular PDA; Left to right shunt PDA none malformation needing operation rectification; ... (including cases of adult PDA approach to severe pulmonary hypertension) Applications and contraindications of OPOTTMIS for simple CHD patients were accepted according to the ACC/AHA 2008 adult CHD administer...
- 9
- 429
- 0
báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps
... and Fig 2a) After the 2nd cell division was occurred, minimal medium containing mM aspartate was given to the 3rd generation of cell (135 after microcultivation) After adding the attractant, tumbling-frequency ... and Tar-localization dynamics (red squares) with chemical stimulation Time course of tumbling frequency (blue circles) and Tar-localization dynamics (red squares) with chemical stimulation Hatched ... change Authors' contributions II carried out the microchamber design, cell preparation, single cell observation, image analysis and drafted the manuscript DS and IK prepared Tar-GFP vector and discussed...
- 4
- 166
- 0
Báo cáo y học: " A single dose of DNA vaccine based on conserved H5N1 subtype proteins provides protection against lethal H5N1 challenge in mice pre-exposed to H1N1 influenza virus" ppt
... Szilvasy I, Paragh G, Pauliny Z, Bartha K, Visontay I, Kis A, Jankovics I: A single- dose influenza A (H5N1) vaccine safe and immunogenic in adult and elderly patients: an approach to pandemic vaccine ... immunity against seasonal influenza viruses is useful in offering protection against H5N1 infection, as has been demonstrated before [14] It also suggests that DNA vaccination may be at least a good ... protective against H5N1 challenge infection in mice Emerg Infect Dis 2002, 8:796-801 Chen Z, Sahashi Y, Matsuo K, Asanuma H, Takahashi H, Iwasaki T, Suzuki Y, Aizawa C, Kurata T, Tamura S: Comparison...
- 9
- 380
- 0
Báo cáo khoa học: "Effect of a single acupuncture treatment on surgical wound healing in dogs: a randomized, single blinded, controlled pilot study" pps
... variables between groups or within groups, between evaluations at and days (p < 0.05) n = 17 per group Day Saarto et al Acta Veterinaria Scandinavica 2010, 52:57 http://www.actavetscand.com/content/52/1/57 ... Sandona F, Casale R, Giron G: The effects of parachlorophenylalanine and naloxone on acupuncture and electroacupuncture modulation of capsaicin-induced neurogenic edema in the rat hind paw A controlled ... Saarto et al Acta Veterinaria Scandinavica 2010, 52:57 http://www.actavetscand.com/content/52/1/57 laser, moxa, injections with different solutions, and permanent implants of gold or other materials...
- 6
- 383
- 0
Báo cáo y học: "Early effect of a single intravenous injection of ethanol on hepatic sinusoidal endothelial fenestrae in rabbits" pdf
... with a carboncoated Formvar film, and subsequently contrasted with uranyl acetate and lead citrate As a size reference, a calibration grid with a spacing of 463 nm was photographed at a magnification ... overnight fast Determination of ethanol concentrations in plasma Plasma ethanol concentrations were measured using the alcohol dehydrogenase assay-based ethyl alcohol Flex™ reagent cartridge (Dade Behring ... that acute ethanol administration in Balb/c mice increased hyaluronic acid levels, a functional marker for sinusoidal endothelial liver cells, at hours and hours, whereas alanine aminotransferase...
- 5
- 419
- 0
Báo cáo y học: "Effectiveness of a single-session early psychological intervention for children after road traffic accidents: a randomised controlled trial" pot
... intervention over time, two factorial analyses of variance (ANOVAs) with repeated measures design were calculated A series of additional analyses of covariance (ANCOVAs) were conducted entering age, ... dealing with traumatic symptoms in an early stage after an RTA Young children can profit from a single- session early intervention around 10 days after an RTA We suggest involving at least one ... American Psychiatric Association: The diagnostic and statistical manual of mental disorders Text revision Washington, DC: American Psychiatric Association, 1994 29 Nader KO, Kriegler JA, Blake DD, Pynoos...
- 10
- 268
- 0
Some studies on a probabilistic framework for finding object-oriented information in unstructured data
... the 22nd international conference on Machine learning [10] Eric Chu, Akanksha Baid, Ting Chen, An-Hai Doan, and Jeffrey F Naughton A relational approach to incrementally extracting and querying ... solution based on its approach with different advantages, however, they also have some shortcomings Information Extraction based solution has low scalability and low adaptability while Text Information ... website usually has its structured information such as location, number of bedrooms, price and area A professor homepage usually contains information about his education, email, department and the...
- 51
- 393
- 0
The 25 most difficult questions you'll be asked on a job interviewThe 25 most difficult questions you'll be asked on a job interview
... For example, if the organization is known for strong management, your answer should mention that fact and show that you would like to be a part of that team If the company places a great deal of ... good manager? Can you give me some examples? WWW.RabElMagd.com WWW.RabElMagd.com Do you feel that you have top managerial potential? Keep your answer achievementand ask-oriented Rely on examples ... more at your age? Say that this is one reason that you are conducting this job search Don't be defensive 23 What you feel this position should pay? Salary is a delicate topic We suggest that you...
- 11
- 511
- 2
Consolidation Chareteristics based on a direct analytical solution of the Terzaghi Theory
... Inflection Sridharan, A and Prakash, K 1995 Discussion on Point Method Geotechnique, 47 (1): 199-200 ‘Limitations of Conventional Analysis of Consolidation Robinson, R.G 1999 Consolidation Analysis ... on Results 2007 Diagnostic Curve Methods for Geomechanics, ASCE, (1): 75-79 of One-dimensional Consolidation Tests, Soils and Sivaram, B and Swamee, P.K 1977 A Computational Foundations, Japan, ... The actual theoretical one-dimensional consolidation relationship between average degree of consolidation U and the time factor T obtained from the Terzaghi theory may, depending on the range...
- 9
- 402
- 0
INFLUENCE DISTRIBUTIONS OF ACID DEPOSITION IN MOUNTAINOUS STREAMS ON A TALL CONE-SHAPED ISLAND, YAKUSHIMA
... total organic carbon, dissolved SiO2, inorganic cations and anions were measured as water quality indicators INFLUENCE PATTERNS OF ACID DEPOSITION Yakushima (area of 503 km2) is a tall, circular, ... radii of a circle on a map (Ebise and Nagafuchi, 2002) We observed these streamwaters at downstream points on the same day every season for past twelve years The water quality in these streams ... most part to those in other areas, the concentrations of Na+ and Cl- were higher Because the Cl- in the streamwater had an atmospheric origin and was concentrated on the canopy between rainfall...
- 6
- 313
- 0
Fuel economy improvement based on a many-gear shifting strategy
... Gear Total Ratio 4th Gear Total Ratio 5th Gear Total Ratio Final Drive Ratio Automatic Gearbox 1st Gear Total Ratio 2nd Gear Total Ratio 3rd Gear Total Ratio 4th Gear Total Ratio Final Drive Ratio ... to make this approach applicable to conventional transmissions, a many-gear transmission concept has been established Fuel economy and gear shifting effects Many approaches are known as feasible ... Based on Pattern Recognition and Learning Algorithm, 4th World Congress on Intelligent Control and Automation, China, 2002 [6] Mashadi B and Kazemkhani A A Fuzzy gear shifting strategy for manual...
- 14
- 475
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25