toward a prototype for passive structures in vietnamese

Báo cáo y học: "Elevated extracellular matrix production and degradation upon bone morphogenetic protein-2 (BMP-2) stimulation point toward a role for BMP-2 in cartilage repair and remodeling" pps

Ngày tải lên : 09/08/2014, 10:21

... CCCCGAGGGCTGTGCTA TGAACTTCAACTGGAACAGGGTATC Aggrecan 0.992 2.15 TCTACCCCAACCAAACCGG AGGCATGGTGCTTTGACAGTG Collagen X 0.992 1.97 CACACTCTGTCCTCGTGCTTTG GGAATCCCTGTAAGACACACCAA Mice were injected intraperitoneally ... Therefore, the safranin O staining intensity was scored in patellar and tibial cartilage with a computerized imaging system There was a significant (30%) increase in safranin O staining intensity ... stimulation also leads to increased VDIPEN staining (k) and NITEGE staining (q,p) Arrows point to intense staining around chondrocytes FastG, fast green; SafO, safranin O Co-incubation of several...

11
401
0

A study on passive voice in English and Vietnamese

Ngày tải lên : 18/03/2014, 10:15

... being painted Active perfect having painted Passive perfect having been painted Active painting Passive being painted Active having painted Passive past to have painted Active perfect to be painted ... the participles The following, for instance, is non-finites of the regular verb: to paint Non-progressive infinitive to have been painted Active to be painting to have been painting painting Passive ... of Vietnamese passive voice In fact, many Vietnamese grammatical and linguistic researchers not agree that there is passive voice in Vietnamese Mr Ban [1992:149] stated that from the view of linguistic,...

46
1.5K
3

A Build for Every Check-In

Ngày tải lên : 05/10/2013, 09:20

... containing information that is sent to the build master info/admin contains this Buildbot administrator’s name and e-mail address, while info/host contains a description of the slave The default ... existing installation chdir /usr/local/buildbot/slave/rsreader creating Makefile.sample mkdir /usr/local/buildbot/slave/rsreader/info Creating info/admin, you need to edit it appropriately Creating ... constants will need to be created along the way The clarity-to-maintainability ratio for the scheduler and builder sections clearly favors duplication Just as clearly, the clarity-to-maintainability...

36
423
0

A comparative study of insults in vietnamese and american english

Ngày tải lên : 26/11/2013, 13:16

... Vietnamese data and the American data were tabulated separately Second, the trends in each group of data for each social factor of age, as well as social status and distance were identified based on ... while being commented as a dog was perceived as a little insulting or even a banter in American culture, it was perceived as very insulting and shoud be avoided in interactions in Vietnamese culture ... aware of and avoid situations where cultural shocks may potentially occur leading to the producing of unintentional insults For language learning and using, in order to effectively interact in...

26
1.5K
1

A study on passive voice in english brief news = nghiên cứu sử dụng thể bị động trong các mẩu tin vắn tiếng anh

Ngày tải lên : 18/12/2013, 10:03

... Minister of Transport and Head of the National Traffic Safety Dao Dinh Binh said at a meeting that traffic accidents in Vietnam are increasing dramatically with the daily average fatalities in ... examples: KANDAHAR, Afghanistan Clash with Taliban leaves at least 19 dead Eighteen Taliban militants and one police officer were killed as Afghan forces and coalition aircraft raided an insurgent ... provinces (Reuters) Japan funds Ha Tay’s General Hospital Ha Tay:_ An agreement was signed on Wednesday by Japanese Ambassador to Vietnam, Daisuke Matsunaga and Nguyen Gia Thuc, director of Ha Tay...

45
2K
2

english adjective antonyms and a contrative analysis with those in vietnamese

Ngày tải lên : 20/12/2013, 18:16

... learning English III.1 Application We can apply adjective antonyms in teaching and learning vocabulary, grammar and writing, reading III.1.1 Vocabulary There are too many adjective antonyms in ... taller than Lan 4,This book is more expensive than that one (CHEAPER) That book is cheaper than this one III.1.3 Reading Antonyms can apply in learning reading When we read a paragraph in a ... have based myself on three main methods IV.1.Analytical method: Analysing materials IV.2.Synthetic method : Synthesising materials, classifying them in a typical way and finding out the suitable...

55
1.1K
16

A STUDY ON LEXICAL COHESION IN VIETNAMESE AND ENGLISH CORPORATE ADVERTISINGS

Ngày tải lên : 29/01/2014, 10:43

... written language, it is important to maintain enough information, appropriate grammatical structures as well as rational organization of sentences Grammatical metaphor: Written language presents rather ... care Healthcare market Care program Health examination Healthcare IT Care setting Healthcare professionals Care management Healthcare products Patient care Healthcare solutions Care plan Healthcare ... to have an overview of the operation and organizational structure As a matter of fact, the advertisements are almost in English that is regarded as an international language How to produce an...

41
1.1K
2

Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf

Ngày tải lên : 18/02/2014, 00:20

... disciplinary, and geographic boundaries and challenge traditional information flows and formal processes for evaluating and vetting ideas—as well as raising legal and policy issues 46 INSTITUTE FOR ... was informed by the insights of an expert group, including: Lada Adamic, Information Dynamics Lab, Hewlett-Packard Laboratories Gene Becker, Strategic Programs Manager, Hewlett-Packard Laboratories ... the basic patterns and mechanisms of symbiosis and parasitism can provide both medical and organizational frameworks for global teams to cooperate in averting disasters and managing outbreaks...

67
893
0

Tài liệu Báo cáo khoa học: "A Method for Correcting Errors in Speech Recognition Using the Statistical Features of Character Co-occurrence" pptx

Ngày tải lên : 20/02/2014, 18:20

... ~'¢ ' "Hai arigatou gozaimasu Kyoto Kanko Hoteru yoyaku gakari de gozaimasu", ('l'hank you for calling Kyoto Kanko Hotel reservations.) Input String: -¢, "A hai arigatou gozaimasu e Kyoto Kanko ... the characters before and after "(" Cte") (3) Both the Error-Pattem-Database and String-Database can be mechanically prepared, which reduces the effort required to prepare the databases and makes ... actual utterance (A) No lacking in the meaning of the actual utterance, and with perfect expression (B) No lacking in meaning, but with slightly awkward expression (C) Slightly lacking in meaning...

5
588
0

Tài liệu Báo cáo khoa học: "A PROGRAM FOR ALIGNING SENTENCES IN BILINGUAL CORPORA" docx

Ngày tải lên : 20/02/2014, 21:20

... just a first step toward constructing a probabilistic dictionary (Table 3) for use in aligning words in machine translation (Brown et al., 1990), or for constructing a bilingual concordance (Table ... (Table 4) for use in lexicography (Klavans and Tzoukermann, 1990) 178 It is remarkable that such a simple approach can work as well as it does An evaluation was performed based on a trilingual corpus ... the distance scores are small, and back off to a lexical approach as necessary Signal Processing ACKNOWLEDGEMENTS We thank Susanne Wolff and and Evelyne Tzoukermann for their pains in aligning sentences...

8
494
0

Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt

Ngày tải lên : 07/03/2014, 11:20

... seen after 26 days of culture mMCP-6 storage showed similar kinetics as for mMCP-5 In contrast, CPA protein was detected as early as after days of culture, and a maximal plateau of storage was already ... decreased in both SG+ ⁄ + and SG– ⁄ – cells This was accompanied by the appearance, from about day 12, of May–Grunwald ⁄ Giemsa-positive granular ¨ structures in SG+ ⁄ + cells A gradual increase in ... Although b-hexosaminidase activity was already detected at day 0, the intracellular content of this enzyme increased markedly after days of culture, and reached a plateau from about day 12 (Fig 2B)...

12
438
0

A Strategy for Cancer Control in Ireland - National Cancer Forum 2006 pdf

Ngày tải lên : 15/03/2014, 00:20

... be a plan for managing and monitoring the screening programme and an agreed set of quality assurance standards • Adequate staffing and facilities for testing, diagnosis, treatment and programme ... capacity of primary care; integrated care pathways and multidisciplinary teams that incorporate palliative care services 36 A formal linkage should be established between the National Cancer Forum ... cancer early, before it has had a chance to spread, remains the best strategy for reducing cancer deaths Examples of early detection include breast awareness, testicular examination and skin inspection,...

68
391
0

Báo cáo khoa học: "A System for Detecting Subgroups in Online Discussions" pptx

Ngày tải lên : 16/03/2014, 20:20

... of the ACL 2010 Conference Short Papers, pages 263–268, Uppsala, Sweden, July Association for Computational Linguistics Aditya Joshi, Balamurali AR, Pushpak Bhattacharyya, and Rajat Mohanty 2011 ... Canada, October Association for Computational Linguistics Amitava Das and Sivaji Bandyopadhyay 2011 Dr sentiment knows everything! In Proceedings of the ACLHLT 2011 System Demonstrations, pages ... 48th Annual Meeting of the Association for Computational Linguistics, pages 138–147, Uppsala, Sweden, July Andrea Esuli and Fabrizio Sebastiani 2006 Sentiwordnet: A publicly available lexical resource...

6
411
0

Báo cáo khoa học: "USES OF C-GP.APHSlil A PROTOTYPE FOR TRANSLATION" docx

Ngày tải lên : 17/03/2014, 19:21

... (l) a "vertical" order or linear order of the arcs having the same initial node and (2) a "horizontal" order or partial order between two arcs on the same path A road is a path from I to Vertical ... and in PASCAL (TS and RSC) For the first approach, we chose regular c-graphs to work with, since there is always a string to represent a c-graph of this class [ ] Vauquois, B LA TRADUCTION AUTOMATIQUE ... (g1+g2)(g3+~2+g4)+61 DEFINITION OF THE PROTOTYPE The prototype consists of a model and a data structure The model is essentially a generalization of a Transformational System (TS) analogous to ROBRA [2] and whose...

4
323
0

Smart Business, Social Business: A Playbook for Social Media in Your Organization

Ngày tải lên : 17/03/2014, 21:31

... Qantas Airlines jet airliner had crashed on Batam Island in Indonesia Qantas Airlines: No Crash, Despite Lots of Rumors After an emergency landing, rumors of a Qantas Airlines plane crash circulated ... stream does not make a business social Pointing to these accounts in marketing and advertising material also not make a business social So what, then, defines a social business? A social business ... reports from TV and Twitter it’s a Qantas airliner which crash at Batam @smillavtr: Chapter Human Capital, Evolved 17 Reports that a Qantas plane may be involved in a crash in Indonesia http://ow.ly/349sJ...

273
310
0

Báo cáo khoa học: "Demonstration of a prototype for a Conversational Companion for reminiscing about images" doc

Ngày tải lên : 23/03/2014, 16:20

... Contains a fully integrated Knowledge Base for maintaining user information including: o Ontological information which is exploited by the Dialogue Manager and provides domainspecific relations ... implemented as an RDF triplestore using a Jena implementation The triplestore API is a layer built upon a traditional relational database The application can save/retrieve information as RDF triples rather ... the Dialogue Action Forms (DAF) to use It has an easyto-use high-level interface for general DAF designers to code associated tests and actions as well as a low level interface for advanced DAFs...

6
271
0

Auditing for Social Change: A Strategy for Citizen Engagement in Public Sector Accountability docx

Ngày tải lên : 30/03/2014, 02:20

... Financial Management Modern day public auditors perform a variety of audits aimed at satisfying different financial management goals Financial audits assess the accuracy and fairness of both the accounting ... increased, as has the demand for strong, open, and participatory monitoring, evaluation, audit, and information sharing; • Many of the existing standards and norms pertaining to ITA are either outdated ... can the media play in publicizing results of audits and advocating for citizen’s right to information? • What are the advantages and disadvantages of the audit community to adopt a media-shy attitude?...

220
373
1

Báo cáo hóa học: "A framework for ABFT techniques in the design of fault-tolerant computing systems" pot

Ngày tải lên : 20/06/2014, 22:20

... KH Huang, JA Abraham, Algorithm-based fault tolerance for matrix operations IEEE Trans Comput C-33, 518–528 (1984) JY Jou, JA Abraham, Fault tolerant matrix arithmetic and signal processing on ... operations at the data-parity level Data processing implementations are protected against Hamidi et al EURASIP Journal on Advances in Signal Processing 2011, 2011:90 http://asp.eurasipjournals.com/content/2011/1/90 ... guarantees that faults representing errors in the processed data will result in notable non-zero values in syndrome sequence Systematic encoding means that the information bits always appear in...

12
574
0

Báo cáo khoa học: "Choice of a model for height-growth in maritime pine curves" pps

Ngày tải lên : 08/08/2014, 19:21

... functions Seber and Wild (1989, p 118) state that "one advantage of finding stable parameters lies This transformation is made for this practical reasons but, being univariate, it has essentially no ... with a data set containing 44 trees belonging to 13 good growing stands, sampled in the Landes de Gascogne area and aged more than 35 years to get the main part of the curve This selection was made ... Chapman-Richards (Richards, 1959) variableshape functions Both curves have parameters, which have the following meanings: A asymptote; r= related to relative growth rate; m shape parameter; and...

10
280
0

Báo cáo y học: "A model of inflammatory arthritis highlights a role for oncostatin M in pro-inflammatory cytokine-induced bone destruction via RANK/RANK" pps

Ngày tải lên : 09/08/2014, 06:22

... causes profound bone damage with osteoclast formation and activation, and increased expression of RANK/ RANKL in inflammatory cells, in inflamed synovium, in articular cartilage and at the invading ... differentiation and activation induced by osteoprotegerin ligand Proc Natl Acad Sci USA 1999, 96:3540-3545 Kobayashi K, Takahashi N, Jimi E, Udagawa N, Takami M, Kotake S, Nakagawa N, Kinosaki M, Yamaguchi ... corresponding to amino acids 317–616 mapping at the carboxy terminus of RANK of human origin [H-300]) or against RANKL (rabbit polyclonal antibody raised against the epitope corresponding to amino acids...

8
380
0