to set a variable named debug in the module named test module
TYING ODYSSEUS TO THE MAST: EVIDENCE FROM A COMMITMENT SAVINGS PRODUCT IN THE PHILIPPINES* pot
... savings balance (hundreds) Active account Barangay’s distance to branch Bank’s penetration in barangay Standard deviation of balances in barangay (hundreds) Mean savings balance in barangay (hundreds) ... door -to- door visit from the Bank “Active” (row 2) defined as having had a transaction in their account in the past six months Mean balances of savings accounts include empty accounts Barangays are ... crowd-out to other savings vehicles at the bank First, we analyze the take-up of the savings products for the individuals randomly assigned to the treatment group Let D i be an indicator variable...
- 38
- 523
- 0
Báo cáo khoa học: Increased sensitivity of glycogen synthesis to phosphorylase-a and impaired expression of the glycogen-targeting protein R6 in hepatocytes from insulin-resistant Zucker fa ⁄ fa rats pptx
... expression or inactivation Linear plots of glycogen synthesis against phosphorylase -a (A) and active glycogen synthase against phosphorylase -a (B) for the data in Figs 2–4 for hepatocytes from Fa ⁄ ? ... corresponding glucokinase activity (Fig 1A) The total activity of phosphorylase (a + b) assayed in the whole homogenate and in the 13 000 g supernatant was 24 and 48% higher, respectively, in hepatocytes ... Zucker fa ⁄ fa hepatocytes C Arden et al 10 mm glucose is higher in hepatocytes from fa ⁄ fa than Fa ⁄ ? rats and also that there is a rightward shift in the plots of glycogen synthesis against...
- 11
- 360
- 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
... domain B) from AMY2 (in green) and TAA (in black) The superimpositioning was guided by the catalytic acids (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2 ... [17] and in contrast to Tyr51AMY2 and Tyr82TAA, the geometry differed of the Met52AMY2 (Met53AMY1) and Trp83TAA (Fig 1A) Also the larger TAA loop in TAA appeared to hinder binding of the substrate ... conserved in plant a- amylases, has a role in substrate binding and activity This local region was different in structures of nonplant a- amylases having a longer ba loop which typically contained aromatic...
- 14
- 557
- 0
Branding Yourself OnlineHow to Use the Internet to Become a Celebrity or Expert in Your Fieldby pptx
... identity as an individual can mean the difference between attracting patrons and creating fans Here are some examples to clarify this concept: Self magazine has readers; Oprah Winfrey’s magazine is ... command is more than enough to allow them to make a living playing their brand of music Contrary to typical corporate strategy, as an individual, you don’t have to win over a huge percentage of the ... possibly be the life of the party if your specialty is accounting, tax preparation, dry cleaning, or plumbing? The same used to be said of car maintenance and repair That is, until Tom and Ray Magliozzi...
- 20
- 359
- 0
Báo cáo lâm nghiệp: "Energy consumption of a chipper coupled to a universal wheel skidder in the process of chipping wood" pptx
... between the maximum power (dependent variable) and wood, assortment and knife angle (independent variables) There was an assumption that the particular parameters influenced each other For the test ... pressed to the part of the stem which was cut The angle α is the final angle of the loading inlet, which is defined by angles α1 and α2 (Mikleš et al 2004) There are many factors influencing the ... shaft torque The other rotating parts are not important due to low weight The average no-load input of the chipper was established as 4.09 kW The no-load input was evaluated and controlled individually...
- 7
- 418
- 1
Báo cáo y học: "A role of ygfZ in the Escherichia coli response to plumbagin challenge" pdf
... PygfZk226AR pQE-Rv_0811c CGGTATAACAGCCGGCCTTAAAGCTG PygfZG227AF CTTTAAGAAAGCCTGTTATACCGGAC PygfZG227AR pQE-ygfZK22 6A GTCCGGTATAACAGGCTTTCTTAAAG pQE-ygfZG22 7A PygfZC228AF CTTTAAGAAAGGGGCTTATACCGGACAAG ... GTCCGGTATACATGCCTTTCTTAAAG PygfZY229AF TAAGAAAGGCTGTGCTACCGGACAAG PygfZY229AR CTTGTCCGGTAGCACAGCCTTTCTTA PygfZT230AF AAGGCTGTTATGCCGGACAAGAGATG PygfZT230AR pQE-ygfZC228M pQE-ygfZY22 9A CATCTCTTGTCCGGCATAACAGCCTT ... CATCTCTTGTCCGGCATAACAGCCTT pQE-ygfZT23 0A PygfZG231AF GCTGTTATACCGCGCAAGAGATGGTG PygfZG231AR CACCATCTCTTGCGCGGTATAACAGC pQE-ygfZG23 1A PygfZQ232AF CTGTTATACCGGAGCAGAGATGGTGG PygfZQ232AR CCACCATCTCTGCTCCGGTATAACAG...
- 13
- 440
- 0
Báo cáo y học: "Combined left hepatectomy with fenestration and using a harmonic scalpel, fibrin glue and closed suction drainage to prevent bile leakage and ascites in the management of symptomatic polycystic liver disease: a case report" pps
... disease and is associated with an autosomal dominant inheritance Patients are usually asymptomatic [1] Symptomatic PLD has been treated by percutaneous aspiration with or without sclerotherapy, ... sclerotherapy, drainage of the superficial cysts into the abdominal cavity and fenestration of deeper cysts into the superficial cyst cavities via laparotomy or laparoscopy, hepatic resection or orthotopic ... promising, and we believe that it may become a valuable means in surgery for PLD Handling of the instrument, cutting and coagulation quality were satisfactory and safe To achieve a better and more...
- 5
- 353
- 0
báo cáo khoa học: " The increasing chronicity of HIV in sub-Saharan Africa: Re-thinking “HIV as a long-wave event” in the era of widespread access to ART" pot
... HIV in the era of expanded treatment access Free public access to life-saving ART became available in parts of Africa in the mid-2000’s, in contrast to many resource-rich countries where ART had ... AIDS-related deaths in Southern Africa Page of dropped by almost one-fifth between 2004 and 2009 [4] The advent of widespread access to ART in Southern Africa marks the dawning of a new era in the ... Cardiopulmonary functions were affected in all groups Gaidhane et al used the ICF to examine self-care among 194 people living with HIV in a tertiary care hospital in rural India, finding that...
- 5
- 225
- 0
Báo cáo khoa học: "Bench-to-bedside review: Thrombocytopenia-associated multiple organ failure – a newly appreciated syndrome in the critically ill" pdf
... plasminogen activator (TPA), streptokinase, urokinase, and defibrinopeptide Therapies used to stop fibrinolysis include aminocaproic acid, tranexamine, and aprotinin PAI, plasminogen activator inhibitor ... greatest in the brain and kidney, these organs are most involved, although Disseminated intravascular coagulation DIC is a consumptive syndrome (consuming pro-coagulant factors such as fibrinogen, ... reduced platelet count are indicative of a greater tendency to bleeding How can prolonged PT/aPTT occur when a patient is in a procoagulant rather than an anti-coagulant state? How can investigators...
- 8
- 185
- 0
Báo cáo khoa học: " Bench-to-bedside review: Brain-lung interaction in the critically ill - a pending issue revisited" ppsx
... pro-inflammatory mediators could occur in all organs, early anti-inflammatory treatment and vasoactive agents might be warranted in the management of the brain-dead donor Brain microglia and astrocytes ... become the main source of inflammatory mediators during acute brain injury Increased BBB permeability in this scenario allows the passage of mediators from brain to periphery, provoking a transcranial ... endexpiratory pressure (PEEP), again suggesting a seeding effect of brain injury in distant organs In a similar context, the application of PEEP levels that inadvertently increase alveolar dead space...
- 5
- 188
- 0
Báo cáo y học: "Using the intervention mapping protocol to develop a community-based intervention for the prevention of childhood obesity in a multi-centre European project: the IDEFICS intervention" pptx
... context Raising awareness among parents about their own role in promoting healthy eating and facilitate their in their ability to create health promoting family environments Creating a school ... intervention framework However, local and cultural adaptation was necessary to make the intervention feasible and to enhance deliverability in all participating countries, this way increasing the likelihood ... Policy and media advocacy Placing the topic on the political agenda; sharing resources; increasing public awareness (module 2) Changes in the environment (module 3) Facilitation School level Forming...
- 15
- 341
- 0
Warehouse management A complete guide to improving efficiency and minimizing costs in the modern warehouse (second edition)
... partner Effectively, to obtain approval to operate a customs warehouse, the applicant has to reach the AEO standards so that achievement automatically grants a waiver from the need for a financial ... Within these chapters we also examine one of the main challenges for warehouse managers – attracting and retaining quality staff Chapters to analyse the individual processes within the warehouse, ... place away from the main storage areas to minimize the risk of temperature deviation (+/–) to goods being held in stock Cold chain management and maintenance of food quality and safety whilst managing...
- 449
- 1,573
- 4
Báo cáo y học: " WT1 PEPTIDE VACCINATION IN COMBINATION WITH IMATINIB THERAPY FOR A PATIENT WITH CML IN THE CHRONIC PHASE"
... 40 6a 27 Oka Y, Tsuboi A, Murakami M, Hirai M, Tominaga N, Nakajima H, Elisseeva OA, Masuda T, Nakano A, Kawakami M, Oji Y, Ikegame K, Hosen N, Udaka K, Yasukawa M, Ogawa H, Kawase I, Sugiyama ... 2000;95:2198-2203 Oka Y, Tsuboi A, Kawakami M, Elisseeva OA, Nakajima H, Udaka K, Kawase I, Oji Y, Sugiyama H: Development of WT1 peptide cancer vaccine against hematopoietic malignancies and solid cancers ... was speculated to be the late effects of imatinib therapy at the dose of 600 mg a day However, bcr-abl transcripts gradually increased to more than 1,000 copies thereafter Since the patient was...
- 10
- 739
- 0
A study of words in the language of sports in english and vietnamese
... lexical influence on learners' perceptions and Instead, they give more importance to grammar and the grammar- production of collocations, we examined the lexical and grammatical translation approach ... important”, A review of the research indicates that the multiple-choice test, the cloze test, and the writing task are common approaches to testing INTERPRETATION OF THE QUESTIONNAIRES RESULTS The ... important maintaining the bounce height up to your hip level only” instead of “… It is important to maintain the bounce …” [75] Athletics, Boxing, Swimming, Basketball, Football, Handball and 4.3.1.2...
- 13
- 819
- 2
Tài liệu Building a Windows IT Infrastructure in the Cloud pdf
... machine is named Gateway and I used to log in with the name Gateway \Administrator Now, however, I’ve created a domain named dkrdomain.local, so I now have to use the name dkrdomain\Administrator ... likely that someone has already done it and saved a snapshot of their running instance as an Amazon Machine Instance (AMI) That means if someone has already saved an OpenVPN AMI, for example, then ... are popular for very large data sets that have to scale horizontally automatically The downside is that they are often limited in the kinds of queries that can be performed against the data they...
- 186
- 800
- 1
Tài liệu Guide to Using International Standards on Auditing in the Audits of Small- and Medium- sized Entities pptx
... losing money and asked Jawad to the analysis again – Suraj gets very annoyed at having to pay any form of income tax and usually pressures Jawad to ensure that accruals are “more than adequate” ... prepared, in all material respects, in accordance with an applicable financial reporting framework The auditor’s objective in a risk-based audit is to obtain reasonable assurance that no material misstatements ... International Standards on Auditing ISAEs International Standards on Assurance Engagements IAPSs International Auditing Practice Statements ISQCs International Standards on Quality Control HOW TO...
- 399
- 543
- 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... of specific chaperone proteins is also required The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1 intermediate Yeast cytochrome bc1 ... PAGE analysis of the mitochondrial membranes isolated from all these deletion strains and from a wild-type strain In the DQCR9, DISP and DBCS1 strains, a protein band of approximately 500 kDa ... mitochondrial encephalopathy [41] It was also shown that the accessory factor Bcs1p in humans is involved in ISP binding into the mitochondrial bc1 complex [41] On the basis of the findings obtained...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing of the gene encoding 4-amino-3-hydroxybenzoate ... decarboxylase) and a deamination step (2-aminomuconic 6-semialdehyde deaminase) in P fluorescens strain KU-7 [7] The decarboxylation mechanism in the metabolic pathways for 3-hydroxyanthralinic acid ... activity In contrast, the deaminase from strain 10d contained an FAD-like cofactor, similar to D-amino acid oxidases [25–27], as indicated by the absorption peak of the purified enzyme at 266 nm The...
- 7
- 613
- 1
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx
... of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and of the first 28 amino acids of the opistoporins were synthesized and were investigated ... with the higher positive charge of parabutoporin, this could explain the higher antibacterial activity on Gram-negative bacteria for parabutoporin compared to opistoporin Also with magainin analogs, ... bacteria and their activity was compared with the activity of melittin and mastoparan (Table 1) Parabutoporin inhibits the growth of all Gram-negative bacteria tested except S marcescens at a...
- 12
- 598
- 0
Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt
... beads at 23 °C with a synthetic phase cytosol fraction was examined and it was found that 60 is necessary to reach a plateau of increased binding affinity (Fig 4A) The same preincubation time was ... was applicable to experiments involving a mitotic phase cytosol fraction (data not shown) The binding of chromatin to GST–NK beads almost linearly increased with increasing chromatin concentration ... egg cytosol fraction (filled bars), and then the binding to chromatin was determined as in Fig (B) The same as (A) except that a mitotic phase egg cytosol fraction was used instead of the synthetic...
- 11
- 563
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25