0

to be an object in a biological system

Regional diversity in the nineteenth century

Regional diversity in the nineteenth century

TOEFL - IELTS - TOEIC

... Usuman and either overthrowing Hausa rulers, as in Zaria, creating emirates by conquest of non-Hausa peoples, as in Bauchi and Adamawa, or intervening to support and supplant non-Hausa Muslims in ... especially responsive to change Msiri’s followers introduced the ancient Chwezi cult into Katanga, a new cult of Nyabingi led resistance to Rwandan expansion, and coastal people incorporated Arabian, ... partly because this region had been unstable since the Moroccan invasion and partly because the jihad was not an internal insurrection but an alien invasion that the Bambara continued to resist...
  • 29
  • 512
  • 0
Chapter 6: Strategy in the Global Environment

Chapter 6: Strategy in the Global Environment

Kế hoạch kinh doanh

... Franchising – A specialized form of licensing where the franchiser sells intangible property (usually a brand or trademark) – The franchisee agrees to follow the strict rules and business plans ... business unit – This can be a very costly approach, since the parent company is responsible for all of the financing Choices of Entry Mode Entry Mode Exporting Licensing Advantages Disadvantages ... Transnational Strategy International Strategy Figure 6.2: Four Basic Strategies Global Standardization Strategy • Focuses on increasing profitability by pursuing a low-cost strategy on a global scale...
  • 25
  • 502
  • 0
Tài liệu A Women’s Health Intervention for Gynecological Problems in the Deployed Environment ppt

Tài liệu A Women’s Health Intervention for Gynecological Problems in the Deployed Environment ppt

Sức khỏe phụ nữ

... significantly contributing to improving female Soldiers’ readiness and filling a gap in military health care identified by experts over a decade ago Women in Bureau of Medicine Operational Obstetrics ... presenting to an evacuation hospital during JH Operation Desert Storm Mil Med 1992 May;157(5):222-4  Hannoun AB, Nassar AH, Usta IM, Zreik TG, Abu Musa AA Effect of war on the menstrual cycle ... 216-219  Wardell, D W., & Czerwinski, B (2001) A military challenge to managing feminine and personal yg ( ) hygiene J Am Acad Nurse Pract, 13(4), 187-193 Women in Bureau of Medicine Operational Obstetrics...
  • 18
  • 734
  • 0
Tài liệu The Right Thing to Do, The Smart Thing to Do Enhancing Diversity in the Health Professions pdf

Tài liệu The Right Thing to Do, The Smart Thing to Do Enhancing Diversity in the Health Professions pdf

Sức khỏe giới tính

... students begin to widen at this stage African-American, Hispanic, and Native American children are more than twice as likely as Asian and white children to be in the lowest quartile in reading and math ... professionals Kington and colleagues noted that African-American and Hispanic patients are less likely than whites to have a regular physician, to have health insurance, to have routine visits with a ... population, African-American, Native American and Hispanic children are underrepresented in programs for “gifted and talented” students, according to Gandara These programs are important because...
  • 377
  • 414
  • 0
Báo cáo khoa học: Localizing matrix metalloproteinase activities in the pericellular environment doc

Báo cáo khoa học: Localizing matrix metalloproteinase activities in the pericellular environment doc

Báo cáo khoa học

... heparan sulfate or chondroitin sulfate glycosaminoglycan chains attached to a protein core, are an important class of cell surface and ECM molecules regulating activation and activity of MMPs Many ... receptor [78] It was also found as a macrophage mannose receptor type C lectin [79] and as urokinase-type plasminogen activator receptor associated protein [80] It has also been characterized as a ... cortactin and actin aggregates at membrane regions adherent to matrix where MT1-MMP accumulates [26] Matrix degradation leads to cortactin dissociation from the area, although MT1-MMP remains associated...
  • 14
  • 264
  • 0
Radionuclide behaviour in the natural environment docx

Radionuclide behaviour in the natural environment docx

Điện - Điện tử

... Rob Wallach and Susan Jackson Biolubricants: Science and technology Jan C J Bart, Emanuele Gucciardi and Stefano Cavallaro Wind turbine blade design and materials: Improving reliability, cost and ... tend to be more similar within a mineral group containing the same anion than for those containing the same cation For instance, carbonate minerals display pKsp values ranging from 8.3 to 13.1 and ... biomass Edited by K W Waldron Understanding and mitigating ageing in nuclear power plants: Materials and operational aspects of plant life management (PLiM) Edited by Philip G Tipping Advanced...
  • 731
  • 272
  • 0
Advanced programming in the UNIX environment

Advanced programming in the UNIX environment

An ninh - Bảo mật

... convention, an argument of means OK, and an argument between and 255 means that an error occurred In Section 8.5, we show how any program, such as a shell or a program that we write, can obtain the ... able to adapt rather gracefully to a networked environment and, perhaps less elegantly, but still adequately, to a graphical one And as it also happened, the basic Unix kernel interface and many ... given that several free BSD alternatives are readily available  Continuing its trend as an innovative company, Apple Computer abandoned its old Mac operating system and replaced it with one based...
  • 1,178
  • 7,043
  • 0
Hazardous Materials in the Hydrologic Environment: The Role of Research by the U.S. Geological Survey docx

Hazardous Materials in the Hydrologic Environment: The Role of Research by the U.S. Geological Survey docx

Điện - Điện tử

... GARY D KRAUSS Staff Officer JACQUELINE MACDONALD Senior Staff Officer JEANNE AQUILINO Administrative Associate ETAN GUMERMAN Research Associate ANGELA F BRUBAKER Research Assistant ANITA A HALL ... contain waste by transferring it to another land disposal facility As a result of amendments to RCRA and CERCLA, there has been a move away from land disposal of hazardous wastes In the mid to late ... capture systematic and stochastic variations in the parameters under study Numerous precautions must be taken to maintain the integrity of samples and minimize contamination Because each analytical...
  • 120
  • 766
  • 0
Báo cáo khoa học: Cold stress defense in the freshwater sponge Lubomirskia baicalensis pot

Báo cáo khoa học: Cold stress defense in the freshwater sponge Lubomirskia baicalensis pot

Báo cáo khoa học

... cDNA library from L baicalensis was prepared in TriplEx2 vector Preparation of antibodies against OA Polyclonal antibodies against OA (pAb-OA) were raised in female rabbits (White New Zealand) as ... baicalensis ingests ⁄ feeds on microorganisms and plankton [7] it is very likely that OA is accumulated in the aquiferous canal system and acts as a protecting metabolite Based on existing data, ... protein phosphatase signature (amino acids 121 and 126) and the conserved matallophosphoesterase (amino acids 57 and 252) The calcineurin-like phosphoesterase (amino acids 57 and 252) overlaps...
  • 14
  • 293
  • 0
INVESTIGATING DIVERSITY IN THE BANKING SECTOR IN EUROPE: THE PERFORMANCE AND ROLE OF SAVINGS BANKS pdf

INVESTIGATING DIVERSITY IN THE BANKING SECTOR IN EUROPE: THE PERFORMANCE AND ROLE OF SAVINGS BANKS pdf

Ngân hàng - Tín dụng

... significant as the merits and drawbacks of each particular form of organisation The case for maintaining a significant savings bank sector in the financial system is wider than any alleged intrinsic ... healthy financial sector or financial system, 2 and what serves as the exact transmission mechanism to the real economy.3 Is a bank-based financial system in some way better than a capital marketbased ... element of a financial system, savings banks may not be useful anymore, that they may be outdated Even having financial institutions that can (still) be characterised as savings banks may be a sign...
  • 214
  • 488
  • 0
advanced programming in the unix environment, 2nd edition, 2005

advanced programming in the unix environment, 2nd edition, 2005

Cơ sở dữ liệu

... standard I/O constants stdin and stdout are also defined in the header and refer to the standard input and standard output Figure 1.5 Copy standard input to standard output, using standard ... support, and many lost weekends over the past year and a half Writing a book is, in many ways, a family affair Thank you Sally, Bill, Ellen, and David I am especially grateful to Brian Kernighan for ... programming language was approved This standard has also been adopted as international standard ISO /IEC 9899:1990 A NSI is the A merican National Standards Institute, the U.S member in the International...
  • 763
  • 6,828
  • 0
whittet d. dust in the galactic environment

whittet d. dust in the galactic environment

Vật lý

... means of an interaction between the spin of the particles and the galactic magnetic field was proposed by Davis and Greenstein (1951) These authors assumed that the grains are paramagnetic and are ... The grains detected by Ulysses and Galileo have radii in the range 0.1 < a < µm and are thus generally larger than typical interstellar grains The apparent lack of a smallgrain component is easily ... rather than by an intrinsic interest in the dust itself or an appreciation of its true significance According to Gaustad (1971) it was once the case, as far as a typical chauvinistic (male) astronomer...
  • 405
  • 281
  • 0
Báo cáo khoa học: Bacteriophages and Pathogenic Vibrio spp in the Aquatic Environment

Báo cáo khoa học: Bacteriophages and Pathogenic Vibrio spp in the Aquatic Environment

Báo cáo khoa học

... methodology at Nanyang Polytechnic, Singapore in November, 2012 Ten countries in Asia participated • In November, 2013, a similar training is planned in association with ILSI Latin America for countries ... BACTERIOPHAGES AS VECTORS OF GENE TRANSFER IN THE NATURAL ENVIRONMENT Lambdoid phages • Lambdoid phages are dsDNA phages They can integrate and excise from the host chromosome catalysed by a phage integrase ... the standing stock of prokaryotes every day • Highly diverse – may have linear or circular dsDNA, linear or circular ssDNA, linear ssRNA or dsRNA LYTIC AND LYSOGENIC STAGES TRANSDUCTION - BACTERIOPHAGES...
  • 34
  • 357
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Constancy and diversity in the flavivirus fusion peptide Stephen J Seligman" ppt

Hóa học - Dầu khí

... CTCGTAGACTGCGTACGATG and GACGATGAGTACTGATCGC at 56°C annealing temperature with Platinum Taq polymerase (Invitrogen, Karlsruhe, Germany) Second round amplification used four variants of each of ... prototype strain Harris was around 92% Because no full sequence of Figure fication step of VIDISCA Original agarose gel photograph obtained from second ampliOriginal agarose gel photograph obtained ... with in- silico analyses CD organised the work, conducted in- silico analyses, and wrote the manuscript All authors have read and approved the final manuscript Acknowledgements This study was supported...
  • 10
  • 405
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Two-Stage Maximum Likelihood Estimation (TSMLE) for MT-CDMA Signals in the Indoor Environment" doc

Báo cáo khoa học

... the signal samples available up to the nth interval and the channel gain estimates are available up to (n − 1)th interval Since we are considering a very slow varying channel, we can replace Gn ... estimates of the quadrature channel gains are computed Here, all channel amplitudes and phase variations are lumped into the quadrature gains, which are considered to be Gaussian processes, and ... can occur when the channel is in deep fade and the detector makes a sequence of errors resulting in a degradation of the estimates Reinitializing the data and gain matrices periodically can alleviate...
  • 12
  • 290
  • 0
THE IMPORTANCE OF BIOLOGICAL INTERACTIONS IN THE STUDY OF BIODIVERSITY pdf

THE IMPORTANCE OF BIOLOGICAL INTERACTIONS IN THE STUDY OF BIODIVERSITY pdf

Điện - Điện tử

... Australia-Pacific Asia Africa Asia Asia Asia Australia-Pacific Africa Asia Africa Asia Americas Asia Asia Asia (12), Americas (5), Africa (3), Australia-Pacific (3), Europe (1) Total: 24 Table Anopheles species ... enhanced by) the human activities Finally, I would like to express my gratitude to Natalia Reinić and Dragana Manestar for their invaluable technical assistance in book publishing I also thank to ... vegetation of the reserve can be characterised as a xerophilous scrubland, and the area has a sub-humid climate This site has an annual mean temperature of 16.1 °C, and its annual mean rainfall...
  • 402
  • 575
  • 1
Advanced Programming in the UNIX Environment docx

Advanced Programming in the UNIX Environment docx

Điện - Điện tử

... stdin and stdout are also defined in the header and refer to the standard input and standard output Figure 1.5 Copy standard input to standard output, using standard I/O #include "apue.h" ... C In late 1989, ANSI Standard X3.159–1989 for the C programming language was approved This standard has also been adopted as international standard ISO/IEC 9899:1990 ANSI is the American National ... starting with a slash, forms a pathname A pathname that begins with a slash is called an absolute pathname; otherwise, it's called a relative pathname Relative pathnames refer to files relative to...
  • 943
  • 359
  • 0
Business in the global environment ppt

Business in the global environment ppt

Điện - Điện tử

... shareholder can be an individual or an organization A company can be a shareholder in another company, as is often the case with parent companies and subsidiaries Financial institutions, such as pension ... organizations become more complex A company can grow ‘organically’ by increasing its capacity and going into new markets without making major structural changes to the organization When company ... networks Financial Penetration of banks and financial services National financial system; regulatory system Cross-border financial flows; regional regulation (for example the European Central Bank)...
  • 38
  • 345
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Rationalization of the performance of a mobile off-road system working in the forest environment with respect to its emission load" doc

Báo cáo khoa học

... (material flows processed by the logging and transport systems), resulting from the changed performance of the system, not always cause a change in power and material consumption and thus a change ... important measures compensating the environment contamination by extraneous substances are preventive measures that can be applied on a larger part of the area of endangered forest ecosystems According ... logging and transport system construction Construction performance performance Energy logging and transport system material Logging and transport system Processed timber processed timber Material...
  • 6
  • 341
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25