this code in the main timeline makes the movie clip called mymc a draggable one
Code in the Cloud doc
... The Pragmatic Programmers, LLC was aware of a trademark claim, the designations have been printed in initial capital letters or in all capitals The Pragmatic Starter Kit, The Pragmatic Programmer, ... software, maintaining the hardware and software where the application runs, making sure that the data is kept safe and secure—none of that is your concern In the cloud, you buy software as a service ... messages Download basechat.py def main( ): room = ChatRoom( "Main" ) markcc = ChatUser("MarkCC") markcc.subscribe( "Main" ) prag = ChatUser("Prag") prag.subscribe( "Main" ) markcc.sendMessage( "Main" ,...
- 306
- 1,936
- 0
Báo cáo toán học: "An optimal strongly identifying code in the infinite triangular grid" docx
... Honkala, An optimal locating-dominating set in the in nite triangular grid, Discrete Math 306 (2006) 2670-2681 [6] I Honkala and T Laihonen, On identifying codes in the triangular and square ... Constellation in Figure As we already remarked after introducing Rule 1, at most one of the codewords c5, d3 and e4 is in C2 , and the others are in C The vertices c4, d5 and e3 are all in N , and therefore ... Laihonen and S Ranto, Families of optimal codes for strong identification, Discr Appl Math 121 (2002) 203–213 [11] A Lobstein, Identifying, locating-dominating and discriminating codes in graphs (Internet...
- 10
- 204
- 0
ethical code in the public accounting profession
... advertising by CPAs that was prohibited by the earlier code In the same year, the Auditing Standards Board issued a package of nine new Statements on Auditing Standards (dubbed expectation gap standards) ... disciplinary action (termination, suspension, and other) and by the source of action (automatic or hearing) Also provided are the averages per year These averages are calculated by dividing the raw ... of the Code by the AICPA members are rare The assumption is that all major cases are detected and adjudicated by the AICPA, state boards of accountancy, and state societies of CPAs There are,...
- 14
- 422
- 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC RPE65c-His-Fwd ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC ... RPE65c in the retina and its subcellular fractionation To analyze the cellular localization of zebrafish RPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf
... side-chain of His210 increased with the decrease in size of the side-chain at residue 169 (Table and Fig 3A) However, the ASAs of Asp113 and His57 remained constant when the side-chain at residue ... aspartate in the catalytic triad is not fully understood because several serine proteases not have an aspartate as the catalytic apparatus M NaCl However, for chymotrypsin-type serine proteases, the ... state B, active state above pH 6.3 side-chain at residue 210 is dispensable, as shown by the fact that H21 0A and H210S are as active as native API with VLK-MCA as a substrate (Table 1) This means...
- 7
- 603
- 0
Tài liệu RESULTS BASED MANAGEMENT IN THE DEVELOPMENT CO-OPERATION AGENCIES: A REVIEW OF EXPERIENCE docx
... resource accounting and budgeting In Australia the main driver for change was the introduction of Accruals-based Outcome and Output Budgeting In Canada, the Office of the Auditor General and the Treasury ... staff and mangers to the tasks at hand Monitoring (collecting) performance data: Once indicators and targets are set, actual data for each indicator is collected at regular intervals Implementation ... space for explanation and justification of the ratings The information from these forms are entered into a central database and analyzed in the Bank’s annual report on portfolio performance (ARPP)...
- 158
- 572
- 0
Estrogen in the adult male reproductive tract: A review ppt
... sections and the ER21 antibody, which is made against a peptide containing the first 21 amino acids of the rat and human ERα (does not cross-react with ERβ), we also found predominant staining in efferent ... reabsorption This inhibition is mediated by a decrease in the expression of NHE3 mRNA and protein and also decreases in carbonic anhydrase II (CAII) and aquaporin I (AQP-1) proteins There is also ... tract using ICC alone Autoradiography and estradiol binding assays indicate that ER is present in the rat epididymis RT-PCR data also show that ERα is present in epididymal tissues [59,108] Therefore,...
- 14
- 370
- 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt
... ¨ incubation with the M sexta clip- domain serine proteinases HP6 or proPO-activating proteinase-1 (data A not shown) In the absence of b-mercaptoethanol, Spatzle-C108 migrated to a position around ... ⁄ PAGE followed by silver staining demonstrated that this step effectively separated Spatzle-C108 from its pro-domain and the acti¨ vating proteinases, and that it remained as a disulfide linked ... hydrolyze the HP8 substrate Ile-Glu-Ala-Arg-p-nitroanilide (IEARpNA) [31] ProHP8Xa lacked IEARase activity, but after the zymogen was activated by factor Xa, IEARase activity increased significantly above...
- 15
- 540
- 0
Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx
... constants corresponding to apparent rate constants are obtained by fitting Eqn (1): DAbs ¼ a þ b eÀct ð1Þ where, DAbs is the variation of absorbance, a and b are amplitude parameters and c is the ... for each experiment Apart from these artifacts the distributions of the residuals show a good agreement between experimental data and the plot obtained by fitting The traces obtained are comparable ... classes according to their values, the analogues of ubiquinone and those of menaquinone, these last having larger differences of coefficients than the first This is not surprising, because menaquinols...
- 8
- 442
- 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx
... 2005 FEBS BMP/activin pathway in Crassostrea gigas ted of its highly variable C-terminal domain after the terminal conserved arginine of the cytoplasmic serine ⁄ threonine kinase domain Sequences ... receptors are in bold and underlined, and the cysteine knot is boxed Also boxed are the transmembrane domain, the ATP binding site, the L45 loop and the serine ⁄ threonine kinase domain (B) The implied ... threonine kinase domain FEBS Journal 272 (2005) 3424–3440 ª 2005 FEBS 3427 BMP/activin pathway in Crassostrea gigas A Herpin et al A Crassostrea gigas C2 domain ALK-6 E fluviatilis C2 domain 77 Crassostrea...
- 17
- 508
- 0
CLEANER PRODUCTION AUDIT IN THE PULP AND PAPER INDUSTRY: A CASE STUDY IN VIETNAM doc
... washing stage ligninand remaining chemicals are removed The depithed pulp is transported to the storage tank then pumped to a beater Waste paper and water are added into beater Here pulp and waste ... for the paper machines including washing wire and washing blanket was measured Then the water consumption for paper machine was calculated from flow rate, paper machine velocity and product amount ... machine The wastewater flowrate from beater cleaning and floor cleaning was not possible to measure In this case wastewater flowrate was assumed equal to water usage in each unit operation The wastewater...
- 98
- 761
- 0
Báo cáo khoa học: Transcriptome profiling analysis reveals multiple modulatory effects of Ginkgo biloba extract in the liver of rats on a high-fat diet pdf
... biosynthesis was repressed and metabolism was enhanced in animals exposed to an HFD with GBE50 Genes involved in fatty acid biosynthesis, such as Acacb, Acbd6 (acyl-CoA-binding domain containing ... Technologies, Santa Clara, CA, USA) Homemade cDNA microarrays containing 10 200 rat genes or ESTs were fabricated as previously described [29–31] The list of the genes on the microarray is available on the ... upregulated genes for an acyl-CoA synthetase member (Acsl1), pyruvate carboxylase (Pc), aspartoacylase (Acy3) and solute carrier family 25 member (Slc2 5a1 ) are involved in lipid biosynthesis, and the...
- 9
- 506
- 0
Postal banking in the United States and Japan: a comparative analysis docx
... Association The Democratic Party platform called for a national guarantee of personal deposits, following what several States had already done starting in 1907, and endorsed postal savings only as ... never spark a financial panic At any rate, the postwar period until the 1990s has been characterized by a nearly universal acceptance of an implicit government guarantee backing financial institutions' ... as well, when a percentage-point change in the number of banking suspensions was associated with about a 0.6 percentage-point increase in the postal savings share (chart 6).27 Chart Postal savings...
- 51
- 409
- 0
ROAR! Get heard in the sales and marketing jungle: A business fable
... industry and layoffs rampant in her company Sitting at Penn Station, sweating from the summer heat and waiting for his train home, Ryan fantasized about trading it all in and joining the Peace Corps ... looking for a job in an environment that was anything but friendly And Christina’s job THE MEETING [5] wasn’t looking all that stable, either, given the big changes in the insurance industry and ... business and their issues At this point, much of the initial sales job is done.” Ryan thought for a moment, moving the remains of his steak around his plate, then asked, “Doesn’t the pain and...
- 225
- 371
- 0
Evidence based Psychological Interventions in the Treatment of Mental Disorders A Literature Review
... comparing measures taken at baseline (the beginning of treatment) and comparing them to measures taken at the end of treatment Increasingly there is a demand for psychologists in the primary ... therapy and medication or medication alone Interventions Psychodynamic psychotherapy plus pharmacotherapy Comparison Groups Pharmacotherapy (pharmacotherapy and clinical management, including psychoeducation) ... during the maintenance phase Psychosocial interventions appear to have the greatest benefit in reducing risk of relapse and improving functioning during the maintenance phase A number of intensive...
- 177
- 1,175
- 0
báo cáo sinh học:" Human resource management in the Georgian National Immunization Program: a baseline assessment" pot
... nized the lack of management format and mandate, resource constraints, and financial and professional motivation as barriers Managers did not seem to think that their own management capacity was an ... Measles-1 Many variables can cause poor rates of immunization including inadequate financing, poor vaccine quality, poor vaccination practices, and weak health care systems [7] but one of the most ... management in the health facilities The doctor is appointed by the head of the policlinic, and the head of the policlinic is appointed by the Ministry of Property Management We have minimal say...
- 10
- 540
- 1
báo cáo sinh học:" The effects of performance appraisal in the Norwegian municipal health services: a case study" pdf
... and position in the organization may be a contributing cause in these differences In Norway, the nurses have the same education as their managers, and very few of the managers of the municipal ... of the study and writing of the manuscript TF participated in the analysis of the data, the sequence Page 10 of 12 alignment and writing of the manuscript All authors have read and approved the ... tables and analyses in this research were valid in the factor analysis The KMO and Test of Sphericity test the null hypothesis that the correlation matrix is valid These factor analyses show that the...
- 12
- 572
- 0
báo cáo hóa học:" Serous papillary adenocarcinoma possibly related to the presence of primitive oocyte-like cells in the adult ovarian surface epithelium: a case report" docx
... a classical histological analysis, and diagnosed the ovarian cancer All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... epithelium of fetal ovaries, and might have been involved in the manifestation of serous papillary adenocarcinoma in this patient They expressed the analyzed markers of pluripotency SSEA-4 and ... serous papillary adenocarcinoma was diagnosed After hematoxylin-eosin staining some corpora albicans, atretic follicles, small inclusion cysts, and rete ovarii were observed Randomly, a proportion...
- 5
- 406
- 0
Báo cáo toán học: " Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach" pot
... analytes For the quantitation of the analytes, a 5-point (PAHs) and a 7-point (pharmaceuticals) internal standard calibration was used The limit of detection and the LOQ were calculated on the basis ... Stadtwerke Trier wastewater laboratory for providing samples and TOC data during the campaign They also thank Margret Roth and Michael Bayerle for their technical support in the chemical analysis ... than that reported in this paper Pharmaceuticals and PAHs The selection of the analyzed organic wastewater pollutants was based on their toxicological relevance in environmental studies and the...
- 13
- 589
- 0
Báo cáo hóa học: " Enabling direct connectivity between heterogeneous objects in the internet of things through a network-service-oriented architecture" docx
... exchanges are a route request, a web page request or a packet acknowledgment IDRA creates the actual packet, encapsulates the information in the payload and stores the resulting packet in a system-wide ... are added to the packet Delay-tolerant parameters can remain in the waiting space for up to a per-parameter predefined period of time If no data have been relayed within the allowed waiting time, ... software services are dynamically combined to form ad hoc applications In regards to the internet of things, SOAs have two main disadvantages [32]: (1) SOAs focus mainly on higher layers rather...
- 14
- 660
- 3
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008