third order intermodulation distortion in bulk acoustic wave devices a phenomenological approach
Bulk Acoustic Wave Theory and Devices pptx
... analogous acoustic relation Recall (1.6) and (1.9): Multiplying (1.6) by v and (1.9) by T and adding gives aT V- + az av Taz = PV- s + T -a at av at (1.27) Using (1.8) (Hooke's law) and assuming ... [a H %] (1.58) Note that S is a symmetric matrix with only off-diagonal terms The displacement gradient matrix (given in (1.49)) is: - au, au, az ax E = au, ay ax au, ax ay az au, - au, ay az ... Acoustic Wave Theory and Devices Rossi, Mario, Acoustics and Electroacoustics Bulk Acoustic Wave Theory and Devices by Joel F Rosenbaum Artech House Boston London Library of Congress Cataloging -in- PublicationData...
- 551
- 220
- 0
Bulk Acoustic Wave Theory and Devices ppt
... analogous acoustic relation Recall (1.6) and (1.9): Multiplying (1.6) by v and (1.9) by T and adding gives aT V- + az av Taz = PV- s + T -a at av at (1.27) Using (1.8) (Hooke's law) and assuming ... [a H %] (1.58) Note that S is a symmetric matrix with only off-diagonal terms The displacement gradient matrix (given in (1.49)) is: - au, au, az ax E = au, ay ax au, ax ay az au, - au, ay az ... Acoustic Wave Theory and Devices Rossi, Mario, Acoustics and Electroacoustics Bulk Acoustic Wave Theory and Devices by Joel F Rosenbaum Artech House Boston London Library of Congress Cataloging -in- PublicationData...
- 551
- 209
- 0
intermodulation distortion in microwave and wireless circuits
... A A Type of Response 3/8 a A A Shift of bias point 3/8 a A A 2 3/8 a A A 2 Second -order intermodulation distortion Third- order harmonic distortion Third- order intermodulation distortion AM/AM ... a A A 2 3/8 a A A 2 0 −2 + 3/8 a A 2 0 −2 + 2 − 3/8 a A 3/8 a A 1 0 2 − 3/8 a A 1 1 1 − + − − + − 2 3/4 a A A 2 3/4 a A A 1 1 + 2 − 2 3/4 a A A 1 2 + 1 − 1 3/4 a A ... by THD = √ a A + a A + i 32 i √ 2 a1 A i = Ai a1 √ a2 + 2 a A + i (2.6) 2.2.4 One-Tone Characterization Setups AM-AM and AM-PM characterizations are performed reading output signal components...
- 447
- 85
- 0
Báo cáo khoa học: The heat shock protein 70 molecular chaperone network in the pancreatic endoplasmic reticulum ) a quantitative approach potx
... (lanes and 4) material were separated by centrifugation, and analyzed by SDS ⁄ PAGE and protein staining with Coomassie Brilliant Blue The protein ladder was run on the same gel (lane 5) ATPase ... Kar2p in channel gating in mammalian microsomes At first, we addressed the question of whether Kar2p functionally interacts with the two relevant J-domains Kar2p was stimulated in its ATPase activity ... membrane ER lumen N C GF J-domain J-domain J domain C N C N Cys GF N ATPase TRX PB BiP domain domain N C J domain J domain ERj3 N Sil1 C N ATPase PB Grp170 domain domain C ERj5 Fig The established...
- 13
- 429
- 0
modeling in transport phenomena, second edition a conceptual approach
... steady- or unsteady-state conditions prevail for the following cases: a) The height of water in a dam during heavy rain, b) The weight of an athlete during a marathon, c) The temperature of an ... 2.1.2 Fouriers Law of Heat Conduction Consider a slab of solid material of area A between two large parallel plates of a distance Y apart Initially the solid material is at temperature To throughout ... temperature To As time proceeds, the temperature prole in the slab changes, and ultimately a linear steady-state temperature is attained as shown in Figure 2.3 Experimental measurements made at...
- 606
- 544
- 0
the acceptance and effectiveness of federal and state information security regulations in multi-branch community banks a phenomenological analysis conducted in central california
... Computer Application Strategy The use of Computer-Aided Qualitative Data Analysis Software (CAQDAS) is an issue which has generated increasing interest in the qualitative research field since computers ... within the categorization imposed by CAQDAS Finally, the real or imagined gains in productivity of CAQDAS may shortchange the benefits of spending a large amount of time manually reviewing the data, ... management accountability for the validity of public financial statements Specific to the area of banking regulation, a number of studies have examined the centrality of acceptance in evaluation...
- 172
- 1,054
- 0
Báo cáo lâm nghiệp: "Variables influencing cork thickness in spanish cork oak forests: A modelling approach" docx
... plot basal area under cork; gmax : maximum basal area under cork; gdom : dominant basal area under cork; apb: area proportional to tree basal area; BAL: mean basal area of the trees larger than ... maximum basal area under cork; gdom : dominant basal area under cork; apb: area proportional to tree basal area; BAL: mean basal area of the trees larger than ith tree where d j > di 307 calibration ... tree diameter increment in stone pine (Pinus pinea): a calibrating approach, Silva Fenn 39 (2005) 37−54 [5] Ca˜ ellas I., Bachiller A. , Montero G., In uencia de la densidad n de la masa en la producción...
- 12
- 299
- 0
Inference in long horizon event studies, a bayesian approach
... they actually appear in the data Since factor loadings and covariance matrices used to simulate individual firm returns are unknown, I also incorporate estimation risk (e.g., Klein and Bawa (1976) ... vq and small diagonal elements in '&~1 result in low amount of shrinkage and large variation across the factor lo a d in gs- T he parameter values for the diagonal elements in \&-1 are set as ... S a m ple X ? fr o m p(Ai | Aj , , A* ) p(Aj | A, 1+1, A3 , , A* ) p{Xd | Aj+1, A} t.\) T he vectors A , A1 , , A1 , are a realization from a Markov Chain It can be shown (Geman and Gem an...
- 81
- 137
- 0
Key areas, causes of FDI firm performance in binh duong industrial zones a qualitative approach
... knowhow, arranging financial packages, obtaining land and establishing plants, hiring and training workers, and so forth With this advantage, business groups excel in repeatedly entering a variety ... company, one finance manager from apparel company, one finance manager and his assistant from textiles company, one finance manager his assistant from footwear company; one manager assistant ... the ten largest foreign direct investors came from Asian countries, namely Japan, China (Taiwan Province), South Korea, Singapore, China (including Hong Kong), Malaysia and Thailand (See Table 2)...
- 88
- 280
- 0
Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt
... 5'TTCCTGAGGGCTCACTGATTAAC and 5'-GAAGGGGAGAGTCAGTTGTTGGAG (external to the ORF) or 5'AGACTGCGGAGATAAAACTGC and 5'-gataaaggtcatcagcctattga (internal to the ORF) PCR products were then cloned in pGEM-T ... cellular and a syncytial trophophoblast layer separating maternal and fetal blood spaces (maternal lacuna, ml, and fetal vessels, fv) All of these characterize the definitive labyrinthine placenta ... stained with haematoxylin and eosin or used for in situ hybridization A PCR-amplified 1135 bp syncytin-Ory1 fragment (primers: 5'-AGACTGCGGAGATAAAACTGC and 5'GTGGACCGCGATTCCTAGTC) was cloned into...
- 11
- 354
- 0
Thickness shear mode acoustic wave sensor in liquid and the frequency interference between laterally coupled channels
... Element Input Resonator Signal Processing and/or Conditioning output Figure 1.1 Schematic diagram of the acoustic wave sensor principles An acoustic wave sensor is a device that uses the elastic waves ... are summarized along with the main enhancement in each aspect 1.2 Developments of the Quartz Crystal Microbalance 1.2.1 Single Quartz Crystal Microbalance Quartz crystal microbalance (QCM) was ... [Yang et al 1993] and interfacial roughness [Schumacher,1985; Daikhin et al 1997,2002] There has been increasing interest in examining not only the frequency changes caused by overlayer, but also...
- 244
- 358
- 0
Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"
... creatinine clearance were always available in both the PB-U and the C-U In addition to the pharmacists' own professional knowledge, clinical guidelines (Up to Date®, Waltham, MA, USA) and an interaction ... file and the laboratory data Renal function was noted for every patient and renal failure was defined as calculated creatinine clearance less than 50 ml/minute The parameters needed to calculate ... and eliminating the use of pull down menus For example, in the case of vancomycin prescriptions, physicians had to order a 'vancomycin loading dose' and a 'vancomycin dose according to plasma...
- 9
- 738
- 1
Topological analysis in bulk power system reliability evaluation
... complicated as the individual bus loads in a composite system not transit at the same time We have approached this problem using a sequential Monte Carlo approach in which each bus load has the ... Reliability Analysis of Multi-Terminal Networks", IEEE Transactions on Reliability, Vol R-30, No 4, October 1981, pp 325-333 12 Satyanarayana, A. , and Prabhakar, A. , "New Topological Formula and Rapid Algorithm ... states to update the freq vertices are automatically sorte the data structures This impr considerably An Algorithm for Calculating th Availability Indices The algorithm for calculating 1) Start...
- 8
- 353
- 0
Báo cáo khoa học: "Efficient Third-order Dependency Parsers" pdf
... training and validation data Pass = %dependencies surviving the beam in training data, Orac = maximum achievable UAS on validation data, Acc1/Acc2 = UAS of Models 1/2 on validation data, and Time1/Time2 ... marginal-probability beam on English parsing For each beam value, parsers were trained on the English training set and evaluated on the English validation set; the same beam value was applied to both training ... parsing; a popular alternative is “transition-based” parsing, in which trees are constructed by making a series of incremental decisions (Yamada and Matsumoto, 2003; Attardi, 2006; Nivre et al.,...
- 11
- 322
- 0
Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc
... cross-talk interactions with other nuclear receptors and with a broad range of other intracellular signaling pathways, including those activated by certain cytokines and growth factors [21,22] It has ... preg, 1 7a- OHpreg, and DHEA, used as standards, showed elution peaks at 4.70, 2.30 and 2.50 min, respectively (Fig 2) In both porcine and human assays using preg as a substrate, an additional peak ... metabolites obtained in assays using human and porcine P450c17 is androstadienol In addition to comigratory behavior on both HPLC and TLC analyses, the identity of the radiolabeled androstadienol...
- 7
- 612
- 0
Báo cáo khoa học: "Learning to Temporally Order Medical Events in Clinical Text" ppt
... The assumption that all MEs in a clinical narrative are temporally related allows us to totally order events within each narrative This works because a clinical narrative usually has a single ... Styler, James Martin, Martha Palmer, James Masanz, and Wayne Ward 2009 Towards temporal relation discovery from the clinical narrative AMIA Marc Verhagen, Robert J Gaizauskas, Frank Schilder, Mark ... clinical narratives, our objective is to induce a partial temporal ordering of all medical events in each clinical narrative based on their proximity to a reference date (admission) The training...
- 5
- 321
- 0
Solutions to the Acoustic Wave Acoustic Wave Equation
... Outline Plane Wave: Dispersion relationship, freq., wavelength, wavenumber, slowness, apparent velocity, apparent wavelength Spherical Wave Green’s function, asymptotic Green’s function Harmonic ... that it is always Perpendicular to wavefront r 2 r= x + y + z r is distance between pt source and observer at (x,y,z) Outline Plane Wave: Dispersion relationship, freq., wavelength, wavenumber, ... slowness, apparent velocity, apparent wavelength Spherical Wave Green’s function, asymptotic Green’s function Spherical Wave in Heterogeneous Medium P= Ae i(wτ - wt) (2) satisfies P = c 2 P except at...
- 19
- 366
- 0
Báo cáo hóa học: "Research Article Iterative Solutions of Singular Boundary Value Problems of Third-Order Differential Equation" potx
... Engineering, Academic Press, Boston, Mass, USA, 1988 16 D Guo, V Lakshmikantham, and X Liu, Nonlinear Integral Equations in Abstract Spaces, vol 373 of Mathematics and Its Applications, Kluwer Academic ... Shandong Scientific Technical Press, Jinan, China, 2000 15 D J Guo and V Lakshmikantham, Nonlinear Problems in Abstract Cones, vol of Notes and Reports in Mathematics in Science and Engineering, ... for a class of third- order nonlinear boundary value problems,” Journal of Mathematical Analysis and Applications, vol 294, no 1, pp 104–112, 2004 14 D Guo, Semi-Ordered Method in Nonlinear Analysis,...
- 10
- 305
- 0
Báo cáo hóa học: " Research Article Stability Analysis for Higher-Order Adjacent Derivative in Parametrized Vector Optimization" ppt
... Sensitivity and Stability Analysis in Nonlinear Programming, vol 165 of Mathematics in Science and Engineering, Academic Press, Orlando, Fla, USA, 1983 T Tanino, “Sensitivity analysis in multiobjective ... Germany, 1989 14 J.-P Aubin and I Ekeland, Applied Nonlinear Analysis, Pure and Applied Mathematics, John Wiley & Sons, New York, NY, USA, 1984 15 J.-P Aubin and H Frankowska, Set-Valued Analysis, ... 385–398, 2007 11 Y Sawaragi, H Nakayama, and T Tanino, Theory of Multiobjective Optimization, vol 176 of Mathematics in Science and Engineering, Academic Press, Orlando, Fla, USA, 1985 12 R B Holmes,...
- 15
- 277
- 0
báo cáo hóa học:" Research Article Comparison Theorems for the Third-Order Delay Trinomial Differential Equations" pptx
... for a third order linear differential equation,” Mathematica ı Slovaca, vol 45, no 4, pp 403–412, 1995 19 A Tiryaki and M F Aktas, “Oscillation criteria of a certain class of third order nonlinear ... differential equation x t Pacific Journal of Mathematics, vol 17, pp 435–466, 1966 13 N Parhi and S Padhi, “On asymptotic behavior of delay-differential equations of third order, ” Nonlinear Analysis: ... 2 Advances in Difference Equations Remark 1.1 All functional inequalities considered in this paper are assumed to hold eventually, that is, they are satisfied for all t large enough In the...
- 12
- 321
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008