... http://www.tbiomed.com/content/6 /1/ 31 provides the option of posting comments on contentious articles within days of their online publication References 10 11 12 13 14 Preuss M, Miller AD: The affinity of the GroEL/GroES ... 2007, 14 :32 21- 32 31 Ikehara K: Pseudo-Replication of [GADV]-proteins and origin of life Int J Mol Sci 2009, 10 :15 25 -15 37 Rodin SN, Rodin AS: On the origin of the genetic code: signatures of its ... different physicochemical properties It is also broadly compatible with the work of Ikehara and colleagues [10 ,11 ] and of Rodin and Rodin [12 ] on the origin and evolution of the genetic code However,...
... VAP2b ⁄ catrocollastatin and catrocollastatin C may be explained by disulfide bond shuffling during experimental determination of cysteinyl pairs for catrocollastatin C (an explanation that we feel ... the Bothrops alternatus snake venom that interacts with alpha5beta1 integrin Arch Biochem Biophys 416 , 17 1 17 9 12 Robeva A, Politi V, Shannon JD, Bjarnason JB & Fox JW (19 91) Synthetic and endogenous ... result of a variety of proteomic and transcriptomic investigations of snake venom and venom glands respectively, numerous databases have been generated that illuminate the complexity of snake...
... at a concentration of 0.25 mgÆmL )1 Samples were scanned from 19 0 nm to 250 nm and accumulated twice at the resolution of1. 0 nm with the scanning speed of 50 nmÆ min )1 The cell length was 0 .1 ... different redox potentials at the final concentration of 0.2 mgÆmL )1 In the redox buffer, the ratio (mM/mM) of GSH to GSSG was : 10 , : 5, 10 : 1, 20 : 1, 30 : and 50 : 1, respectively Simultaneously, ... disulfide bonds, of which at least two are non-native The denatured states of HPI under varying concentrations of urea and GdnHCl are shown in Fig With increasing concentration of denaturant, an increasing...
... analysis of native gels) was investigated (Fig 1) At 31 °C, wild-type MCAD gave the highest level of activity of the three proteins, with 9550 nmol ferriceniumÆmg )1 h )1 (Fig 1A) This increased to 11 ... · 10 3 23.8–24.9 · 10 3 24.6 · 10 3 6 21 19 K364R Direct linear Confidence limits (68%) Wilkinson Standard error 5.38 5.09–5.87 5.67 0 .18 6 25.5 · 10 3 25.4–25.6 · 10 3 25.6 · 10 3 274 19 .8 4552 19 .1 19.9 ... analysis of native PAGE gels, indicative of relative amounts of soluble tetramer No MCAD activity was detected in lysates of cells expressing R256T, but, at both temperatures, the folding of this...
... formation of [methyl -14 C]5-methylthioribose -1- phosphate from 5¢-[methyl -14 C]MTA [10 ] In all enzymatic assays, the amount of the protein was adjusted so that no more than 10 % of the substrate ... known catalyst of oxidative folding, is a multifunctional eukaryotic enzyme that utilizes the active site motif CGHC to catalyze the formation of native disulfides and the rearrangement of incorrect ... less than that of the natural redox reagent glutathione Therefore, this CXC peptide is able to function as an efficient catalyst of disulfide isomerization [26] On the basis of these observations,...
... details of the ‘iron–sulfur switch’ regulating this protein in metazoan cells Experimental procedures Strains and media Strains W303-1B (mat a, ade2 1, ura3 1, his3 11 , trp1 1, leu2–3 ,11 2, can1 10 0), ... blot of the same fractions Lane 1, recombinant human IRP1; lanes 2– 11 , fractions 1 10 of the sucrose gradient (C) Fraction 10 was diluted in Tris buffer (lane 1) or Tris buffer containing 1% Triton ... m-hIRP1 production in the KGD1 mutant (B) Ultrastructural analysis of BY47 41: KGD1 producing m-hIRP1 Two images are shown m, mitochondrion Bars ¼ 200 nm 10 88 FEBS Journal 274 (2007) 10 83 10 92 ª...
... Biophys J 75, 10 84 10 96 15 Baldwin, R.L (19 96) On-pathway versus off-pathway folding intermediates Fold Des 1, R1–R8 16 Baldwin, R.L (20 01) Folding consensus? Nat Struct Biol 8, 92–94 17 Kim, P.S ... an intermediate state in the unfolding pathway of HSA (Fig 1A) To verify that the intermediate state was indeed a part of the folding Fig Kinetics of secondary structure formation of HSA during ... M, ± 0. 01 M and 1. 5 ± 0 .1 M for h, 12 h and 24 h of refolding, respectively The results together indicated that the stability of the intermediate state decreased with increasing incubation time...
... His-XHdown (5¢-ATCGTCGGG CTCAGGATCCTTAGTGATGGTGATGGTGATGAGA TGAAGATGAAGCTGAAGA-3¢), for Gas1523-H, or His-XH-Sdown (5¢-GTCGTCGAGCTCAGGATCCTTA GTGATGGTGATGGTGATGATCAACACTACCTGAT GCAGA-3¢), for sGas1482-H ... His-tagged forms sGas1523, sGas1E161Q and sGas1E262Q (B) Representative purification of sGas1523-H Silver staining of the different steps of the purification are shown Lane 1, culture supernatant; lane ... EMBO J 15 , 18 2 19 1 27 Fonzi, W.A (19 99) PHR1 and PHR2 of Candida albicans encode putative glycosidases required for proper cross-linking of beta1,3- and beta -1, 6-glucans J Bacteriol 18 1, 7070–7079...
... Closed-loop, multiobjective optimisation of analytical instrumentation: gas-chromatography- time -of- flight mass spectrometry of the metabolomes of human serum and of yeast fermentations Anal Chem 2005; 77: ... information into a multitude of cell fates These epigenetic mechanisms are crucial for the function of most, if not all, chromatin-templated processes and link alterations in the chromatin structure ... elucidation of the Type III secretion apparatus (TTSS) common to many Gram-negative pathogens The TTSS allows for the specific injection of bacterial proteins into human host cells, where they mediate...
... secondary structure 312 12 17 18 19 20 21 22 23 using a simple matrix multiplication Anal Biochem 15 5, 15 516 7 Matulis D & Lovrien R (19 98) 1- Anilino-8-naphthalene sulfonate anion-protein binding ... co-translational pro- FEBS Journal 278 (2 011 ) 295 315 ê 2 010 The Authors Journal compilation ê 2 010 FEBS 313 RNA-dependent conformational states of UDE 50 51 52 53 54 55 56 57 58 59 60 61 62 314 A ... the position of the 208-nm peak (Fig S1) Quantitative evaluation of the CD data is shown in the bar graph FEBS Journal 278 (2 011 ) 295 315 ê 2 010 The Authors Journal compilation ê 2 010 FEBS 299...
... detection system 14 15 16 17 18 19 20 21 22 F Forneris et al spectrometry, thermal shift (ThermoFluor) assay, and multiangle or static light scattering Methods Mol Biol 426, 299– 318 Lo MC, Aulabaugh ... measurements of ellipticity at 222 nm in the temperature range 25–70 °C with a constant heating rate of °CÆmin )1 LSD1 ⁄ CoREST reconstitution and inhibition assays Human LSD1, mgÆmL )1 in 50 mm ... Amicon concentrator (Millipore Corp., Billerica, MA, USA) with a 30 kDa cutoff to a final concentration of 20 mgÆmL )1 A set of 15 buffers at 50 mm concentration in the pH range 4.2 10 .6 was prepared...
... Jahn and S E Radford 10 11 12 13 14 15 16 17 18 19 20 21 22 23 of the protein topology universe Trends Biochem Sci 30, 13 19 Vendruscolo M, Paci E, Dobson CM & Karplus M (20 01) Three key residues ... relative free energies of partially folded states of proteins Proc Natl Acad Sci USA 10 0, 14 817 14 8 21 Bollen YJ, Sanchez IE & van Mierlo CP (2004) Formation of on- and off-pathway intermediates ... weak hydrophobic environment of a chaperonin cavity: creation of an alternate fast folding pathway Proc Natl Acad Sci USA 10 1, 13 192 13 197 61 Sekijima Y, Wiseman RL, Matteson J, Hammarstrom P, Miller...