therefore the company shall not prepare its annual accounts on a going concern basis if management determines even after the balance sheet date that it intends to liquidate the company or cease trading or that it has no realistic alternative but to do so
... separation of ownership and management corporate taxation government regulation Organizing a Corporation • The process of creating a corporation begins when the organizers (incorporators) obtain ... obtain a charter from the state • The charter authorizes the corporation to issue stock and conduct business in accordance with state law and the corporation’s bylaws Organizing a Corporation • Stockholders ... board of directors alone hasthe authority to declare a dividend Dividend Dates Three relevant dates for dividends are: Declaration dateDate of record Payment date Objective Account for Cash...
... fiscal year-end but before the financial statements are issued Noteworthy Events and Transactions Transactions or events that are potentially important to evaluating acompany s financial statements, ... assets and liabilities Identify and describe the various balancesheet asset classifications 3-6 FedEx Corporation BalanceSheet 31-May Assets are probable future economic benefits obtained or ... appropriate corresponding total, or base amount, within the same year Horizontal Analysis Vertical Analysis Allows analysts to control for size differences over time and among firms Ratio Analysis...
... rises ithas more money’ ◆ If I compare the results of two businesses, the one which has made more profit has done better’ ◆ The accountant balances theBalanceSheet by entering a balancing ... seem familiar ◆ TheBalanceSheet tells me the value of the business’ ◆ ‘At the year-end the retained profit must be somewhere; in the bank, orthe accountant’s drawer’ ◆ Ifthecompany s share ... operating profit, financing costs, published format CLASSIFICATION OF EXPENDITURE Why classify? Capital or Revenue? control THEBALANCESHEET Use of Funds (Fixed Assets, Working Capital), Source...
... ‘profits’ ithasthe opportunity to plough back some of the money ithas made to self-finance its future growth ● Retained profit is money the business has made itself ● It is thereforethe cheapest ... thecompany s share price rises ithas more money Ifit falls, ithas less.’ Apart from when thecompany wishes to raise new share capital or is warding off a takeover bid, the share price hasno ... security or collateral (so thatthe loan can be recovered ifthe borrower defaults) THE BUSINESS FINANCIAL MODEL SOURCE OF FUNDS LOAN CAPITAL - EXAMPLE Taking out a mortgage is a similar process to...
... in Working Capital? ● Not all the stock will have been paid for Therefore Working Capital is the value of Current Assets less the amount owed to suppliers: WORKING CAPITAL = CURRENT ASSETS less ... despatched tothe customer This timing difference is one of the factors contributing tothe outcome that PROFIT CASH ≠ CASH RAW MATERIALS DEBTORS/ RECEIVABLES PR SAL ES OF R P ● SH CA SA Cash ... this working capital and that is exactly what the investment hasto WORK! ● Cash is used to buy Raw Materials, which are converted into Work in Progress, and through to ● Sold to customers,...
... year the meter is set to zero and the profits are measured as they are re-cycled 33 NOTES 34 CLASSIFICATION OF EXPENDITURE CAPITAL or REVENUE? Page Why Classify? 36 Classification of Expenditure ... capital expenditure, the second two are revenue 37 CLASSIFICATION OF EXPENDITURE WHAT WILL ITDOTO MY PROFIT? EXPENDITURE AL T PI CA REVENUE FIXED ASSETS Depreciation Raw Materials Wages & Salaries ... included in Attributable Cost - and hence reduces profit as soon as the product/service for which it was purchased is sold CLASSIFICATION OF EXPENDITURE CONTROL CAPITAL EXPENDITURE ● Commits Long -Term...
... Depreciation) 48 Working Capital 51 Source of Funds 53 The Balancing Act 56 Summary 59 Published Format 65 45 THEBALANCESHEET INTRODUCTION SHARE CAPITAL LOAN CAPITAL RETAINED PROFITS SOURCE ... THEBALANCESHEET FORMAT TheBalanceSheet format swops the two halves of the model over: ● ● Use of Funds appears at the top of the statement Source of Funds appears at the bottom of the statement ... 49 THEBALANCESHEET DEPRECIATION OF FIXED ASSETS Depreciation is not applied to land (with the exception of quarries and mines) It is applied to all other Fixed Assets: 50 THEBALANCESHEET WORKING...
... COMMON MISCONCEPTIONS The accountant balances theBalanceSheet by entering a balancing figure somewhere probably profit.’ TheBalanceSheet balances automatically because for every transaction ... Retained Profits) 61 THEBALANCESHEET SUMMARY Here is the same BalanceSheet expanded to itemise the Fixed Assets and the constituent parts of Working Capital: BalanceSheet as at 31st December ... valued at a standard or ‘nominal’ value (see page 54) ● LOAN CAPITAL long-term borrowings from Banks (or similar institutions) ● RETAINED PROFITS the accumulation of profits re-invested into the...
... THEBALANCESHEET INTERNAL FORMAT ● The format examined to this point has addressed an internal report totheManagement Team ● The focus has been to consider theManagement decisions in ... return onthe Net Capital Employed ● The Report provides essential management information 65 THEBALANCESHEET PUBLISHED FORMAT TheBalanceSheet published format A Report tothe Owners of the ... referenced totheBalanceSheet ● 68 In most companies theBalanceSheet is subject to external audit (Note: different rules now apply for small companies) The format is required to show the comparative...
... Note - Interest must be paid whether thecompanyhas had a good year or not, sothe greater the loan capital within the business, the greater the financial risk ● Tax: Whilst businesses aim to ... PROFIT AND LOSS ACCOUNT PROFIT NOT CASH ● Goods received, and not yet used for the products that have been sold will appear as Stock ontheBalanceSheet ● Goods received, butnot yet paid for ... of Directors and /or leave thecompany vulnerable to takeover bids p11 Sothe way Earnings are divided hasto be a political decision Substantial shareholders, eg, financial institutions, will...
... (usually 12 months) Creditors: The amount of money thecompany owes its suppliers (also referred to as Payables) 22 Debtors: The sum owed tothe business by its customers (also referred to as ... the format may not look dissimilar tothe internal management format Preceding years’ figures are required to be shown Figures shown are totals only - some analysis will be available in the Notes ... PROFIT AND LOSS ACCOUNT COMMON MISCONCEPTIONS If I compare the results of two businesses, the one which has made more profit has done better.’ Not necessarily What matters is not profit but...
... used MATTER It affects - Profit Product Cost Fixed Asset Values Don’t let the accountant take sole responsibility! 106 About the Authors Anne Hawkins, BA, CIMA is aManagement Accountant with a first ... modules within Masters Programmes in the UK and overseas Contact For details of support materials available to help trainers and managers run finance courses in -company, contact the authors at: Tall ... DEPRECIATION 101 APPENDIX TWO CALCULATING DEPRECIATION How accountants decide how much depreciation to charge? Depreciation is Assessed on an annualbasis by apportioning the ‘depreciable amount’...
... E214QRV (CGGATCCACTGCTTTGGTAACCCTGAACAGCAACAATTTGG); and for the E214S mutation, E214SFW (CCAAATTGTGGCTGTTAGCGGTTACCAAAGCAGTGGTTCCGC) and E214SRV (GCGGAACCACTGCTTTGGTAACCGCTGACAGCCACAATTTGG) The insert ... Xyn1 1A, Nicotiana tabacum cv Havana, and two local varieties, Alcalá and Para soThe diameter of infection areas for the two local varieties were about half the value obtained for Havana, and ... fused toa poly-His tag to facilitate purification The mgfp4 gene [38] was then amplified from the nos-GFP cassette [39] with either primer pairs GFP-BAM (5’-GCGGATCCGATGAGTAAAGGAGAAGAAC-3’) and...
... block than acompany with a disreputable past You are worth more as an honorable company with a good reputation than one noted for sleazy management practices and a terrible reputation in the marketplace ... to some tough questions about how and why organizations behave in certain ways.2 What is attractive about the concept is notthe sports metaphors, butthe idea that different organizations have ... Plan Another example of a plans-driven organization is the military unit preparing for war The precursor to battle is thorough planning, buteven this has limits Every good commander knows that...
... Audit Manager Joseph Cooney, Acting Audit Manager Midori Ohno, Lead Auditor Richard Borst, Senior Auditor Louis Lee, Senior Auditor Abraham Millado, Senior Auditor Jackie Nguyen, Senior Auditor ... Niguel, California; Atlanta, Georgia; Cincinnati, Ohio; and Salt Lake City, Utah; the Campuses7 in Fresno, California; Atlanta, Georgia; Covington, Kentucky; and Ogden, Utah; and non-IRS offsite facilities ... methods for backup tapes at non-IRS offsite facilities Impact onthe Taxpayer The IRS annually processes more than 220 million tax returns containing personal financial information and personally...
... International Bar Association the global voice of the legal profession The International Bar Association (IBA), established in 1947, is the world’s leading organisation of international legal practitioners, ... regulatory and product development It also produces an annual newsletter for its members In addition toits programmes at theannual IBA conferences, the Committee presents an annual conference on ... Concurrent session B: UCITS IV Payment details I enclose a cheque/bank draft made payable tothe IBA for the total amount payable I have transferred tothe IBA bank account the total amount payable...
... for the Channel Cay area increased the number of available SST measurements by a factor of two over Night data alone Day+ Night data also gave us a more valid basis of comparison with the in situ ... error bars indicates thatthe error was too small to appear onthe graph The asterisk onthe abscissa marks the onset of high-temperature anomaly in August 1998 Hard corals include Scleractinia ... fragmentation, its potential for recolonization is low following removal from a large area (Knowlton 1992) Ag tenuifolia, in contrast, possesses life-history characteristics that favor its colonization...
... the motivation and the talent to obtain terminal degrees in their disciplines also have the ability to take highly paid positions in the corporate sector When a professor decides to forsake a ... because they yield significant differences in the amount of resources individual institutions have available to build top-notch educational facilities and offer salaries and benefits that allow ... not- for-profit enterprises providing a benefit for society as a whole— not just for shareholders The table shows a ratio of presidential salary tothe average salary for a full professor onthat campus The...
... units into 2014 At Plant Hatch, an on- site dry storage facility became operational in 2000 Sufficient dry storage capacity is believed to be available to continue dry storage operations at Plant ... dividends paid per share of common stock The accompanying notes are an integral part of these statements 33 SOUTHERN COMPANY AND SUBSIDIARY COMPANIES 2001 ANNUAL REPORT CONSOLIDATED BALANCE SHEETS AT ... otherwise made available to satisfy obligations of Southern Companyor any of its other subsidiaries 52 SOUTHERN COMPANY AND SUBSIDIARY COMPANIES 2001 ANNUAL REPORT NOTES (CONTINUED) Bank Credit Arrangements...
... for the harmonization of the national legislation with the international regulations and standards in this area The main change was the fact that, in accordance with the international best practice, ... license or approval; That information in the OCD does not match that in the license orthe approval; and Thatthe actual condition of the goods does not match the data indicated in the license orthe ... of national capacities for the strategic approach tothe international chemical management and a workshop onthe establishment of national priorities for the Strategic Approach to International...