therapeutic diet for celiac disease
Tài liệu Seropositivity for celiac disease in children and adolescents with short stature doc
Ngày tải lên :
12/02/2014, 19:20
... investigation for
clinical conditions compatible with celiac disease (anemia,
short stature, and abdominal pains)
(35)
.
Celiac disease is a cause of short stature that should not
be forgotten, ... methods with good
sensitivity and specicity for the screening and diagnosis
of celiac patients.
The anti-tTG assay emerged as a great hope for celiac
disease screening, since it is an easily-executed ... may reduce the number of
cases positive for celiac disease, particularly where villous
atrophy is less severe
(14,25,26)
. Seronegative cases of celiac
disease do occur; these patients have a...
- 5
- 610
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
Ngày tải lên :
07/03/2014, 10:20
... cost. There is no cure for AD,
and the development of effective therapeutic strategies
is hampered by a paucity of information on the biolo-
gical mechanisms underlying the disease. The severity
of ... dysfunctional events characteristic of Alzheimer’s disease. Metal-based
therapeutics have already provided promising results for the treatment of
Alzheimer’s disease, and new generations of pharmaceuticals ... phosphorylation [75]. Therapeutic modulation of
metal bio-availability, such as that described by White
et al. [60] and Malm et al. [75], may therefore repre-
sent a potential therapeutic strategy for preventing
the...
- 9
- 634
- 0
Báo cáo khoa học: Therapeutic approaches for prion and Alzheimer’s diseases pot
Ngày tải lên :
07/03/2014, 10:20
... 134–
141]. Therefore, there is a great need for effective therapies for both Alzhei-
mer’s disease and prion diseases.
Abbreviations
ACT, a1-antichymotrypsin; AD, Alzheimer’s disease; Ab, amyloid-b; ... be
beneficial for treatment of Ab accumulation in AD
[14,105,106]. Whether similar approaches can be used
for prion disease remains to be determined.
Prion disease
Interest in prion disease has ... of arresting or at
least effectively modifying the course of disease do not yet exist for either
one of these diseases. Alzheimer’s disease is the major cause of dementia in
the elderly and has...
- 15
- 581
- 0
Milk Diet As A Remedy For Chronic Disease- p1 potx
Ngày tải lên :
15/03/2014, 00:20
... mixed diet, the patient is given medicines for the
relief of pain, or for the reduction of temperature, stimulants or sedatives for
the heart, cathartics for the bowels or diuretics for the ... I am not afraid to give the milk diet in any case of diseased blood
vessels, or in aneurism caused by disease, for I believe the blood carries its
own cure for these conditions, but COMPLETE ... varied diet, by taking the milk
treatment for a few weeks.”
Where it is the intention of patients to keep on with the milk diet for
very long after stopping the rest cure, it is advisable for...
- 101
- 454
- 0
Báo cáo y học: "Thioglycosides as inhibitors of hSGLT1 and hSGLT2: Potential therapeutic agents for the control of hyperglycemia in diabetes"
Ngày tải lên :
26/10/2012, 10:04
...
culture for 2 days to allow the cells to form a confluent
monolayer culture. For transport studies cells were
seeded in 96-well microtiter scintiplates (PerkinElmer,
Wiesbaden, Germany). For fluorescence ... foundation for future studies
with the objective to determine the clinical applica-
tions of thioglucosides in human diseases like diabe-
tes.
Acknowledgments
We thank C. Pfaff and P. Glitz for their ...
2.29 for hSGLT1 and hSGLT2, respectively. Thioglyco-
side I showed a small but significant change in cell
membrane depolarization with a fluorescence signal
ratio of 1.15 for hSGLT1 and 1.29 for...
- 9
- 650
- 0
A Diet for Healthy Bones
Ngày tải lên :
26/10/2013, 19:15
... exercise are good for your bones?
ã
Pass out “Building Strong Bones with Exercise” handout.
Lesson 2: Page 5
A Diet for Healthy Bones
University of California, Berkeley ã Center for Weight & ... history of heart disease at an early age (before 45 for men and 55 for
women)
What else do I need to know about exercise?
Start Slowly
Gradually build up how much time and effort you do exercising. ... risk for developing osteoporosis; however, African American and
Hispanic women, and men can still get osteoporosis.
5.1 Learning Activity
ã Pass out A Diet for Healthy Bones pamphlet for participants...
- 59
- 254
- 1
Therapeutic yoga for heart health
Ngày tải lên :
23/01/2014, 07:34
... heart
health. Therefore and much more, therapeutic yoga may be used to preserve, or
improve, heart health both in those who have and haven't had cardiac arrest.
Using therapeutic yoga ... less inclined to
experience another cardiac arrest or develop every other heart disease. It is
because yoga fortifies the center and encourages health and fitness.
Practicing yoga and remaining ... method for inactive individuals to
heart health - http://thomsonlifestylecentre.com/healthy-heart-screening-package
http://thomsonlifestylecentre.com/healthy-heart-screening-package
Therapeutic...
- 4
- 385
- 0
Prevalence of Celiac disease in Turkish children with type 1 Diabetes Mellitus and their non-diabetic first-degree relatives pptx
Ngày tải lên :
05/03/2014, 12:20
... patients with
celiac disease. SIGEP Study Group for Autoimmune Disor-
ders in Celiac Disease. Gastroenterology 1999; 117: 297-303.
21. Freemark M, Levitsky LL. Screening for celiac disease in
children ... Soci-
ety for Pediatric Gastroenterology, Hepatology and Nutri-
tion. Guideline for the diagnosis and treatment of celiac di-
sease in children: recommendations of the North American
Society for Pediatric ... Hospital,
Department of Pediatrics, for various reasons,
such as trauma or minor respiratory infections.
All the subjects were tested for total IgA levels to
exclude IgA deficiency and screened for IgA-tTG
antibody....
- 5
- 453
- 0
Natural remedies for poultry diseases common in ‘natural’ and ‘organic’ flocks potx
Ngày tải lên :
08/03/2014, 09:20
... seeds are said to
be good for the control of tapeworms in laying
hens.
Pasture management for parasite control
There are very few de-worming products avail-
able for use with organic or ... form
different formulation
4
the coop area the chickens will eat the juicy
leaves and succulent bright orange or yel-
low flowers helping to rid them of any inter-
nal parasites.
DISEASE ... University, Frankfort. Copyright 2011 for materials developed by University of Kentucky Cooperative Extension. This publication may be reproduced in portions or its entirety
for educational and...
- 6
- 569
- 0
Báo cáo Y học: The analysis of the fine specificity of celiac disease antibodies using tissue transglutaminase fragments pot
Ngày tải lên :
08/03/2014, 09:20
... found in the serum of celiac
disease patients.
Keywords: autoimmunity; celiac disease; transglutaminase;
epitope mapping; phage display.
Celiac disease (CD) is a genetic disease strongly linked ... Duration of
exposure to gluten and risk for autoimmune disorders in
patients with celiac disease. SIGEP Study Group for
Autoimmune Disorders in Celiac Disease. Gastroenterology 117,
297–303.
24. ... AGCTCG
AGATCT
AACGCCTGGTGCCCAGCGGA 140–147
Core for TGAAGC
GAATTC
TTACTCCCTCTCCTCTGAGGACC 454–448
Loop for TGAAGC
GAATTC
TTAACGGATCCGCATGGCCATCC 479–473
C1 for TGAAGC
GAATTC
TTACTCCAGGTAGAGGTCCCTCT 585–579
C2 for TGAAGC
GAATTC
TTAGGCGGGGCCAATGATGAC...
- 7
- 506
- 0
Treat for incurable diseases potx
Ngày tải lên :
17/03/2014, 16:20
... rights reserved. â Copyright 2004 Treatments-4-Incurable-Diseases.us
Alternative Treatments for Incurable Diseases page 18
Chapter Three Diet For The Acutely Ill
The acutely ill person experiences ... rights reserved. â Copyright 2004 Treatments-4-Incurable-Diseases.us
Alternative Treatments for Incurable Diseases page 12
Chapter Two Diet For The Chronically Ill
The chronically ill person ...
American diet.
If the chronically ill had been following a vegetarian diet, perhaps a diet
All rights reserved. â Copyright 2004 Treatments-4-Incurable-Diseases.us
Alternative Treatments for Incurable...
- 29
- 229
- 0
Celiac Disease Among Children and Adolescents pot
Ngày tải lên :
22/03/2014, 10:20
... study.
Practice Points
● Celiac disease is a common, but frequently unrec-
ognized disease. Consequently, celiac disease is
severely underdiagnosed.
● The health burden of celiac disease is considerable.
Two ... Group
on Celiac Disease and Malignancy of the European Society
for Paediatric Gastroenterology Hepatology and Nutricion.
Cancer in children with celiac disease: a survey of the
European Society for ... picture (% of symptoms) of childhood celiac disease in the Netherlands 1993 to 2000 (*P Ͻ 0.05).
TABLE 2. Some diseases associated with childhood celiac
disease (CD)
Disease
Frequency
of CD (%)
Reference
Down’s...
- 20
- 482
- 0
Gene Transfer Approaches for Gynecological Diseases pot
Ngày tải lên :
22/03/2014, 11:20
... correction of either genetic
or somatic disease phenotypes or for expression of
molecules within or near target cells for therapeutic
effect. Vehicles for gene transfer include both nonviral
and ... useful approach for the treatment of diseases refractory to
conventional therapies. Various preclinical and clinical strategies have been explored for treatment
of gynecological diseases. Given ... transfer applications for gynecological
diseases.
Key Words: gene transfer, gene therapy, ovarian cancer, cervical cancer, gynecological disease
Contents
Introduction 154
Gene Therapy for Ovarian Cancer...
- 10
- 348
- 0