the yield curve as a forecasting tool for inflation and the business cycle

Báo cáo y học: "Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children" ppt

Báo cáo y học: "Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children" ppt

Ngày tải lên : 13/08/2014, 18:21
... general, and anxiety and depression specifically, among Arab children and adolescents in the MENA region The validation revealed that the AYMH scale has reasonably good construct validity and ... Cronbach’s alpha As for validity analysis, the diagnostic assessment of depression and anxiety by the psychiatrist was used as standard reference The Receiver Operator Curve method was used to ... measure their prevalence and risk factors, there is a clear need for more culturally adapted and validated scales for use among youth The AYMH scale fills an important gap and addresses some of the...
  • 7
  • 386
  • 0
Tài liệu mẫu phân tích IPA  Importance   performance analysis as a strategic tool for destination attractiveness an analysis of domestic

Tài liệu mẫu phân tích IPA Importance performance analysis as a strategic tool for destination attractiveness an analysis of domestic

Ngày tải lên : 01/08/2014, 10:25
... institutions like the Vaastu Vidya Gurukulam, which gives training in vaastu shastra and a school for Mohiniattam dancer Further, the tourists can learn handicrafts, local cuisines, rural games and mingle ... heritage and art forms, local festivals, road drives and activities for children As (1) asserted that it is important to measure consumer satisfaction applying as many destination attributes as ... these areas may offer only little advantage Attributes that are rated high in importance and low in performance are areas that the providers should pay particular attention for improvement Lastly,...
  • 7
  • 874
  • 3
Báo cáo khoa học: "Evaluation of a Bacillus stearothermophilus tube test as a screening tool for anticoccidial residues in poultry" doc

Báo cáo khoa học: "Evaluation of a Bacillus stearothermophilus tube test as a screening tool for anticoccidial residues in poultry" doc

Ngày tải lên : 07/08/2014, 18:21
... rebmun A la te sisylana DPAR aidnI ,ragantazI ,etutitsnI hcraeseR yranireteV naidnI ,yrotarobaL airetcabocyM eht ta muidem nesneJ-nietsnewoL no deniatniam dna ]62[ stset lacimehcoib dna )gniniats ... sisylana )DPAR( AND cihpromylop deifilpma modnar yb sniarts )CEPA( iloc E cinegohtap naiva fo noitaitnereffiD B S nosnevS ,J najayeerpisaS ,P atoosamaR ,N iahcnropirisnahC 49-58 ,3 ,1991 lppA sdohteM ... gniraeppa dnab AND a fo )0( ecnesba ro )1( ecneserp fo sisab eht no tliub saw dna slaremun eht fo desopmoc xirtam atad A hpargotohp a no deton erew DPAR yb deniatbo snrettap gnidnab ehT )ynamreG...
  • 7
  • 323
  • 0
Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

Ngày tải lên : 09/09/2015, 18:56
... Laboratories, PA, USA) The following primers were used: HSVtk, 5'-CCCATATCGGGGACACGTTATTT3' (forward) and 5'-GATAAAGACGTGCATGGAACGGAG-3' 5'-CCTGGATGCCGAACAAGGTTTA-3' (forward) CCAGCGTTCAATGCCTTCAAAC-3' TGGTGTTCCTATTGGCGGATGTCT ... GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA -3’ (reverse), size:1.2kb; Fcy 5’-AGGAATTCATGGTGACAGGGGGAATG -3’ (forward) and 5’- CCGCTCGAGCTACTCACCAATATCTTCA -3’ (reverse), ... interfering RNA 13 1.1 Glioblastoma Malignant brain tumors such as glioblastoma multiforme (GBM) and childhood brain cancer, medulloblastoma, have remained virtually untreatable and lethal The median survival...
  • 134
  • 439
  • 0
báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc

báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc

Ngày tải lên : 19/06/2014, 10:20
... sends the data to a specific device or machine that then copies the data to the various people that are subscribers to the data For example, a user send their data to a multicast address and the ... of the available fiber has been lit, and each fiber has several terabits/s of capacity The dot-com implosion has made this dark fiber and wavelengths of light in the fiber, very affordable The ... Beyond the virtual room was a landscape consisting of mountains, meadows, sky and clouds The floor was the distance from the subject's eyes to the virtual floor and the nearest column was 4.6 m away...
  • 10
  • 449
  • 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Ngày tải lên : 19/02/2014, 16:20
... 2xi are not described as single reactions in our formalism, as stoichiometry b would exceed one What remains for a1 is all the reactions that have xi as the substrate and not as the product Therefore, ... kinase, and v1 should then represent the dephosphorylation of E2-P, as catalyzed by E1 This reaction releases P and E2 In this reaction E1 is used but immediately released as it is a catalyst The ... necessary for the negative graph to induce sustained oscillations We shall analyze the steady states, because the presence of steady states on the phase-space border and the irreversible steady-state...
  • 11
  • 638
  • 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Ngày tải lên : 07/03/2014, 10:20
... stress, a loss of regulation of Ab production, and an increase in tau hyperphosphorylation Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors...
  • 9
  • 634
  • 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt

Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt

Ngày tải lên : 16/03/2014, 05:20
... blot analysis appeared rather broad, probably because large amounts of unlabeled CFMYP and EGMYP naturally present in the gonads formed broad bands and affected the shape of the bands of the labeled ... substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The normality ... testis at stage 1, and eggs In all of the samples analyzed, a large protein peak was observed at an elution position of 72 mL (peaks a, b, c, and d), where the estimated molecular mass was about...
  • 14
  • 442
  • 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Ngày tải lên : 23/03/2014, 15:21
... red algal protein than with the cyanobacterial one The C paradoxa thylakoid membranes also contained a band cross-reacted with anti-(R-PsbQ¢), the apparent molecular mass of which was remarkably ... cyanobacteria [22] and that C paradoxa first branched during the evolutionary process of chloroplasts [23] Shibata et al [21] isolated the thylakoid membranes and PSII particles from C paradoxa and reported ... glaucophyte, C paradoxa that has the most primitive plastids [23], contained the PsbV and PsbU proteins as the extrinsic proteins (Figs and 2) A primitive red alga, C caldarium that has the most ancient...
  • 11
  • 501
  • 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Ngày tải lên : 18/06/2014, 16:20
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and ... on their own, not account for T1 D protection in NOD.B6 Idd3 mice [22] Candidate-gene approaches have also demonstrated a role for the Idd3 locus in human celiac disease and RA [25], as well as...
  • 12
  • 573
  • 0
báo cáo hóa học: " Cultural adaptation into Spanish of the generalized anxiety disorder-7 (GAD-7) scale as a screening tool" pot

báo cáo hóa học: " Cultural adaptation into Spanish of the generalized anxiety disorder-7 (GAD-7) scale as a screening tool" pot

Ngày tải lên : 18/06/2014, 19:20
... information losses in the statistical analysis A total sample size of 210 subjects was therefore considered adequate The retest sample was selected at random as a sub sample from the scaling and validation ... domain), and the WHO-DAS II disability questionnaire was calculated Concordance between classification criteria was assessed by inter-rater agreement statistics (kappa) and a Chi-square test All ... defining GAD The ASQ-15 allows for detecting GAD according to DSM-IV and ICD-10 criteria, as well as other anxiety symptoms, but no version adapted to and validated for our culture is available On the...
  • 11
  • 537
  • 0
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx

Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx

Ngày tải lên : 21/06/2014, 05:20
... in the IPM plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small ... provinces with a standard questionnaire The survey concentrated on current cashew husbandry practices, assessment of cashew production, labour use and costs, pest and disease practices and assessment ... ants, ladybirds, preying mantis or birds These data clearly show that farmers lack extensive knowledge about the insect pests and diseases and their natural enemies Weaver ant status and farmers’...
  • 10
  • 551
  • 1
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf

Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf

Ngày tải lên : 21/06/2014, 06:20
... include the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, the use of weaver ants in cashew ... in the TOT training, and they includes the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, ... in the same cashew orchards as we did five months ago in Dong Nai, Ba Ria Vung Tau and Binh Phuoc The orchard in Ba Ria-Vung Tau was sprayed by the orchard owner, which was unexpected The data...
  • 12
  • 531
  • 1
Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf

Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf

Ngày tải lên : 21/06/2014, 06:20
... Vietnam, there are at least 10 major insect pests and three diseases as well as many important species of natural enemies such as parasitoids and beneficial fungi in cashew orchards These data clearly ... knowledge of cashew insect pests and diseases and their natural enemies, and Weaver ant status and farmers’ opinion of them The results are summarised below A total of 212 cashew farmers were interviewed, ... cashew farming status Based on this baseline survey, the majority of cashew growers were small holders, having about of orchards with the average tree age being years (for grafted materials) and...
  • 7
  • 400
  • 0
Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf

Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf

Ngày tải lên : 21/06/2014, 06:20
... in cashew orchards, (2) to make them aware of the existence and the role of natural enemies (especially weaver ants) on cashew trees, and (3) to provide them with information about the advantages ... of physical factors in the cashew agroecosystem, the mutual relationships among cashews, animals and humans in cashew orchards, and up-to-date cashew cultivation techniques, especially variety ... tree performance, the establishment of cashew orchards, the basic farming skills to manage cashew orchards, cashew variety selection, the principles of fertilizer application and the appropriate...
  • 24
  • 453
  • 0
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt

Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt

Ngày tải lên : 21/06/2014, 06:20
... base, and each larva excavated a chamber in which the calcareous pupal cell was formed from the excretions of the larva Pupation took place late in the year The pupa is about 35 mm long, creamy-white, ... ant abundance was greatly reduced from 65% in early January to below 15% late January As a result, the main insect pest damage was much higher and the yield was much lower in the IPM plot than ... oils, Abamectine and water, respectively Data analysis For field experimental data analyses, on each monitoring occasion, two plots (farmer and IPM) were ranked, based on mean percentage damage...
  • 26
  • 491
  • 0
Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx

Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx

Ngày tải lên : 21/06/2014, 06:20
... methods and skills, and their understanding of the cashew IPM program A lot of farmers said that it was the best training they had received about cashews Although weaver ants are abundant, the farmers ... successfully passed their examinations Each of them was awarded a graduation certificate in the cashew IPM training Now, we have 112 TOT cashew IPM trainers, and they are distributed in ten cashew growing ... methods, and they were very interested in the field practical All the master trainers did their best to pass their knowledge to the TOT trainees A final examination at the end of each TOT training was...
  • 10
  • 302
  • 0
Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt

Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt

Ngày tải lên : 21/06/2014, 06:20
... weaver ants, and would use weaver ants and tell their friends and other farmers to use the ants Farmers’ knowledge about insect pests, diseases and their natural enemies as well as general farming ... program • Parts and take an ecological approach to characterise the effects of physical and biological factors on cashew tree performance, and to demonstrate how to apply the up-to-date farming ... farmer’s plot, but the average damage was < 1% and < 2% for mealy bugs and aphids respectively (Table 7) (5) The average yield of cashew nuts per tree were similar between the IPM plot and the...
  • 37
  • 394
  • 0
Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt

Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt

Ngày tải lên : 21/06/2014, 06:20
... program, for the part of the TOT training and for the field data analyses Dr Pham Van Bien and Mr La Pham Lan are in charge of Vietnamese personnel and expenses of the project Mr Lan is also ... (Helopeltis antonii), that caused the majority of damage on flushing shoots The most important natural enemies were weaver ants (Oecophylla smaragdina) and crametogaster ants (Crematogaster sp) The effect ... since the project started Baseline data of the insect pest assemblage and their damage were obtained Regular monitoring and sampling of insect pests and their natural enemies in the demonstration...
  • 10
  • 327
  • 1
Báo cáo lâm nghiệp: "Wedge prism as a tool for diameter and distance measurement" ppsx

Báo cáo lâm nghiệp: "Wedge prism as a tool for diameter and distance measurement" ppsx

Ngày tải lên : 07/08/2014, 10:21
... of the diameter at various heights of stem using the wedge prism as a tool for measurement is a sufficiently accurate method for measurement and can be used for measuring the diameters in the ... on the borderline The method was also described for determining the tree diameter at breast height (Bitterlich 1996) For testing the accuracy of the method the laser telemeter was used and then ... of the angle gauge (b) b a (a) α borderline Table Average values and their differences Diameter measured optically with wedge prism Diameter measured with calliper Difference Standard deviation...
  • 4
  • 444
  • 0