the type of literature such as a novel or a short story
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
Ngày tải lên :
28/03/2014, 20:20
... for their assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon ... risk of heart failure found that the waltz was just as good as traditional aerobic exercise and that people were happier, which was demonstrated by increases in a measure of quality of life, and ... enjoyed their experience, as the classes appeared to foster community involvement and became a source of social support for the members The pace of the Argentine tango lessons was at the level of the...
- 19
- 648
- 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
Ngày tải lên :
10/08/2014, 10:23
... was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales If reliability was lower than 0.7, an exploratory ... measurement of Helicobacter Pylori serology (HPS) following eradication therapy Therefore, the aim of the study was to undertake a theory-based process evaluation study to explore whether the ... intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking the mean...
- 9
- 367
- 0
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt
Ngày tải lên :
12/08/2014, 17:22
... program for MATLAB software (Natick, MA, USA) by an orthopedic researcher who was blinded to the treatment groups The average of the disc height index (DHI) was calculated as a ratio of the average ... COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and gene expression analyses Nine rabbits were euthanized weeks after either Link N or saline injection, and ... Reverse: GGAGAACATATGGTCCCAACGT GAPDH Forward: ACTCTGGCAAAGTGGATG 60 Reverse: TCCTGGAAGATGGTGATG expression of the Link N-treated discs was normalized to saline-treated discs Biochemical analysis...
- 9
- 402
- 0
A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2
Ngày tải lên :
16/07/2015, 07:45
... enthusiastic support i ABSTRACT Since the application of Communicative Language Teaching approach to EFL teaching, process writing and collaborative learning have been greatly emphasized as typical ... research problem, the rationale for the study as well as aims, significance, scope and methods of the study Moreover, the research questions are also clearly stated to act the parameter for the ... research topic was given, which laid the theoretical basis for the whole study This chapter aims at elaborating on the participants and setting, justifying the research instruments as well as...
- 65
- 893
- 7
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique
Ngày tải lên :
26/10/2012, 09:32
... men; mean age 64, range 22-89) were included Length of follow-up was at least years with a maximum of years Location of facet pain was cervical in 45, thoracic in 15, and lumbar in 114 patients ... in facet-related pain as measured by Visual Analog Scale (VAS) score at final follow-up visit Secondary outcome was change in OSWESTRY disability index from preoperative evaluation to final follow-up ... 71% of 21 patients at one year follow-up with laser denervation of the dorsal facet capsule Li et al treated patients with RFA of the dorsal rami Three patients had durable response after to 16...
- 4
- 599
- 0
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning
Ngày tải lên :
05/09/2013, 16:10
... where air and water are in contact, water will always tend to adiabatic saturation temperature, as in the case of the adiabatic tunnel described before To clarify what has been exposed before, the ... stream and transfer it to the secondary air in the evaporative cooling process They can be made either of metal or plastic and must easily conduct heat, maintain the two streams separated and ... humidifying of the air while passing through the bank of tubes The capillary flow can be increased by using a more porous material The characterization of the experimental device was performed by an experimental...
- 28
- 652
- 0
A STUDY ON THE USE OF CLASSROOM DISCIPLINE AS MOTIVATION FOR SECOND LANGUAGE ACQUISITION IN THE CONTEXT OF ENGLISH LANGUAGE TEAC
Ngày tải lên :
07/09/2013, 13:06
... (1996) accepts the view of discipline as a synthesis presence of a number of complementary factors She also emphasizes the equal importance among the factors as well as pictures the general look of ... can take place: the social side of teaching - To impart, by a variety of means, knowledge to their learners: the task-oriented side of teaching All in all, a teacher can be addressed as a manager, ... ‘ The Practice of English Language Teaching’ (Jeremy Harmer, 1991) The writer chooses to view the teacher as an informant, a facilitator, a monitor, an assessor, an organizer, a controller, a...
- 41
- 887
- 12
An investigation into the effects of brainstorming and giving a text as model on phan dinh phung high school student's attitude and writing ability
Ngày tải lên :
18/12/2013, 10:08
... students began to be regarded as thinker or creators of language, instead of the traditional views as empty to be regarded ad thinkers or creators of language, instead of the traditional view as empty ... disapproval of the application of giving a text as a model at prewriting stage in the future As has been proved, majority of students had negative attitude toward giving a text as a model The majority ... reasons of approval of the application of brainstorming in the future Table 9: The reasons for disapproval of application of brainstorming in the future Chart 5: The control’s group feelings about...
- 60
- 717
- 0
Itzhak Perlman: a citizen of the word, with his violin as a passport
Ngày tải lên :
11/03/2014, 15:38
... For a few moments, close your eyes and imagine you are in a theater In front of us is the stage To the left, Itzhak Perlman sits in his chair, near the conductor The orchestra has already played ... the first two movements of Beethoven's D Major Concerto The violin leads us to the third, and immediately announces the major theme Listen now as Itzhak Perlman performs with the Philharmonia ... Philharmonia Orchestra of London Carlo Maria Giulini is the conductor (MUSIC) Our program was written and produced by Paul Thompson I’m Steve Ember Join us again next week for the VOA Special English...
- 2
- 400
- 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
Ngày tải lên :
16/03/2014, 05:20
... as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The normality ... of these pathways, according to the demand for zinc; the latter pathway appears to be more important in females than in males, for the transport of larger amounts of zinc After its release from ... normality of the distribution of data was evaluated using the Kolmogorov–Smirnov test The equality of the standard deviations of the groups was assessed with Bartlett’s test The Tukey–Kramer...
- 14
- 442
- 0
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
Ngày tải lên :
17/03/2014, 23:20
... aging A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic ... neurons and cardiac myocytes) for life maintenance Mitochondria are the main source of ROS formation, as well as the main target for free radical attack The accumulation of defective mitochondria within ... & Terman, A (1999) The mitochondrial-lysosomal axis theory of cellular aging Understanding the Basis of Aging: the Roles of Mitochondria, Free Radicals, and Antioxidants (Cadenas, E & Packer,...
- 7
- 444
- 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
Ngày tải lên :
23/03/2014, 05:22
... GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG ... an abnormal brain architecture, whereas, in MAP2 deficient mice, the cytoarchitecture was normal, suggesting an overlapping function of MAP2 with MAP1b [20] Lack of functional alteration in cases ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 92431–92404...
- 14
- 416
- 0
báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc
Ngày tải lên :
19/06/2014, 10:20
... is to have most of the main data-set replicated across all the sites and transmit only incremental changes Furthermore the main data-set is often cached locally at each of the collaborating sites ... reconstruct a missing packet The virtual representation of a remote collaborator (avatar) is often captured as the position and orientation of the 3D tracking devices that are attached to the stereo- ... present an optimal pathway for central control of postural orientation as there are many cues in the visual flow field that can identified for anticipatory processing The important parameters of the...
- 10
- 449
- 0
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
Ngày tải lên :
19/06/2014, 22:20
... microglial NADPH oxidase maybe largely responsible for the oxidative damage observed in the AD brain Astrocytes and the NADPH oxidase Astrocytes are the most abundant glial cell type in the brain and ... radicals can damage tissue adjacent to the sites of inflammatory action; therefore, the activation of the NADPH oxidase is tightly controlled though regulated assembly of the individual oxidase ... microglial NADPH oxidase has not been established Antioxidant therapy and the NADPH oxidase Considerable attention has been devoted to antioxidants as a potential therapeutic intervention in AD These...
- 12
- 413
- 0
Báo cáo khoa học: "Bioavailability of the amino acid-attached prodrug as a new anti-HIV agent in rats" pdf
Ngày tải lên :
07/08/2014, 23:22
... htob erusaem ot desu saw )ASU ,tneligA( nevo nmuloc a dna ,)ASU ,tneligA( relpmasotua na ,)ASU ,tneligA( ressaged a ,)ASU ,tneligA( pmup a ,)ASU ,tneligA( rotceted VU yarra edoidotohp a gnidulcni ... LA1050-PV rof alumrof eninala dica onima eht yb ytilibaliavaoib fo tnemevorpmi ehT etadidnac gurdorp wen a rof yrotcafsitas erew amsalp ni noitartnecnoc fo ecnanetniam eht dna ,mrof evitca na ... noitartsinimda suonevartni retfa 2050-PV fo sretemarap citenikocamrahP elba T 562 star ni tnega VIH-itna wen a sa gurdorp dehcatta-dica onima eht fo ytilibaliavaoiB nwohs sah ,siht ot roirp demrofrep...
- 5
- 211
- 0
Báo cáo lâm nghiệp: " Effects of ectomycorrhizal inoculation and the type of substrate on mycorrhization, growth and nutrition of containerised Pinus pinea L. seedlings produced in a commercial nursery" docx
Ngày tải lên :
08/08/2014, 00:22
... by Forestal Catalana S.L in Breda (Girona, Northeastern Spain) A factorial experiment was set up in order to check the effect of the factors: (a) inoculation with spores of the five ectomycorrhizal ... When factors interacted, they were separately analysed by one-way ANOVA Percentages of ectomycorrhizas were arc-sin transformed before performing ANOVA Figure Percentages of ectomycorrhizal short ... tested was effective to obtain mycorrhizal P pinea seedlings produced in container The high quantity of spores that can be obtained from one basidioma and the ease of application of this type of inoculum...
- 6
- 509
- 0
Báo cáo khoa học: "Evaluation of the fullerene compound DF-1 as a radiation protector" doc
Ngày tải lên :
09/08/2014, 08:23
... molecular work, and assisted in the animal studies AS and AT performed the animal work and assisted in drafting the manuscript EC, MU, and WS participated in the design of the study and assisted ... (Nordion International, Kanata, Ontario, Canada) was used as the ionizing radiation source The irradiator was calibrated with thermoluminescent dosimetry chips implanted in phantom mice The radiation ... radicals and thus reducing indirect DNA damage As a measure of radiation-induced DNA damage, we evaluated induction of nuclear foci of phosphorylated histone H2AX (γH2AX), which has been established...
- 9
- 384
- 0
Báo cáo khoa học: " Intensity modulated radiotherapy (IMRT) in the treatment of children and Adolescents - a single institution''''s experience and a review of the literature" pps
Ngày tải lên :
09/08/2014, 10:20
... Laskar S, Bahl G, Muckaden M, Pai SK, Gupta T, Banavali S, Arora B, Sharma D, Kurkure PA, Ramadwar M, Viswanathan S, Rangarajan V, Qureshi S, Deshpande DD, Shrivastava SK, Dinshaw KA: Nasopharyngeal ... ago as part of multimodality treatment of an acute lymphoblastic leukaemia About four years later he presented with an anaplastic astrocytoma and therefore received external beam radiation to the ... nasopharyngeal angiofibroma, esthesioneuroblastoma and rhabdomyosarcoma with three patients each Table shows more detailed information about the patients' characteristics Treatment location was...
- 10
- 523
- 0
Báo cáo y học: "Acquired hemophilia as the cause of lifethreatening hemorrhage in a 94-year-old man: a case report" pot
Ngày tải lên :
11/08/2014, 03:20
... performed, with a ratio of patient’s plasma to normal plasma of 1:1) (Figure 1) Quantitative assays revealed a reduced level of factor VIII activity (1%) and the presence of factor VIII inhibitor ... TK analyzed and interpreted the patient data and was a major contributor in writing the manuscript JR analyzed the patient data and contributed in writing the manuscript RP and BE analyzed and ... based on the lack of an alternative bypass agent such as recombinant activated FVII (rFVIIa) in the setting of acute severe bleeding Oral prednisone therapy (60 mg/day) was given, and he also received...
- 4
- 496
- 0
Báo cáo y học: "Acquired hemophilia as the cause of lifethreatening hemorrhage in a 94-year-old man: a case report" potx
Ngày tải lên :
11/08/2014, 07:20
... performed, with a ratio of patient’s plasma to normal plasma of 1:1) (Figure 1) Quantitative assays revealed a reduced level of factor VIII activity (1%) and the presence of factor VIII inhibitor ... TK analyzed and interpreted the patient data and was a major contributor in writing the manuscript JR analyzed the patient data and contributed in writing the manuscript RP and BE analyzed and ... based on the lack of an alternative bypass agent such as recombinant activated FVII (rFVIIa) in the setting of acute severe bleeding Oral prednisone therapy (60 mg/day) was given, and he also received...
- 4
- 397
- 0